Table 1.

PCR conditions

PolymorphismPCRPrimers/Probes(Mg2+)[Primers, Probes]AmpliconCycling
DNMT3b −149C>TFP5′TGTTCACTTCCAGTTGTCCTGAA3′3 mmol/L200 nmol/L118 bp50°C, 2 min, 95°C, 10 min, 40× 95°C, 30 s; 62°C, 60 s
RP5′GGACACTCACTGGGCCTTAG3′200 nmol/L
C allele5′VIC-CAGACCCCAGGCCT-3′NFQ100 nmol/L
T allele5′6FAM-AGACCCTAGGCCTCCA-3′NFQ100 nmol/L
DNMT3b −283T>CFP5′ GTTCGGGTTGAAAGGAGCC3′6 mmol/L200 nmol/L86 bp50°C, 2 min, 95°C, 10 min, 45× 95°C, 15 s; 65°C, 60 s
RP5′ GAAGCCCTAAGCGGGAGG3′200 nmol/L
T allele5′VIC-CAAAACCAGACTCCTT-3′NFQ100 nmol/L
C allele5′6FAM-CAAAACCAGGCTCCT-3′NFQ100 nmol/L
DNMT3b −579G>TFP5′CAAAGGCAAGTGACTTGGAAAA3′4 mmol/L200 nmol/L82 bp50°C, 2 min, 95°C, 10 min, 45× 95°C, 15 s; 60°C, 60 s
RP5′CCAGGATTAGATAGAGAACGAGTAAAAAA3′200 nmol/L
G allele5′VIC-AAATCCCCGCTGAAA-3′NFQ100 nmol/L
T allele5′6FAM-TAAATCCCAGCTGAAAC-3′NFQ100 nmol/L
ADH1C 1045A>G
FP5′ CAATGATATTTTCTTCTTTTCAGGCTTT3′5 mmol/L200 nmol/L109 bp50°C, 2 min, 95°C, 10 min, 50× 95°C, 15 s; 60°C, 1 min
RP5′GCGAAGCAGGTCAAATCCTT3′200 nmol/L
A allele5′VIC-CATTAATAACAAATATTTTACC3′-NFQ150 nmol/L
G allele5′6FAM-CATTAATAACAAATGTTTTACCT-3′NFQ100 nmol/L