Table 1.

Primers and probes for quantitative multiplex methylation-specific real-time PCR

ForwardReverse
Cyclin D2
    R1TATTTTTTGTAAAGATAGTTTTGATTACAACTTTCTAAAAAATAACCC
    R2 UMTTAAGGATGTGTTAGAGTATGTGAAACTTTCTCCCTAAAAACCAACTACAAT
    R2 MTTTGATTTAAGGATGCGTTAGAGTACGACTTTCTCCCTAAAAACCGACTACG
    P UMHEX-AATCCACCAACACAATCAACCCTAAC-BHQ1
    P M6FAM-AATCCGCCAACACGATCGACCCTA-BHQ1
APC
    R1GGGTTAGGGTTAGGTAGGTTGTGAACTACACCAATACAACCACATA
    R2 UMGTGTTTTATTGTGGAGTGTGGGTTCCAATCAACAAACTCCCAACAA
    R2 MTATTGCGGAGTGCGGGTCTCGACGAACTCCCGACGA
    P UM6FAM-AACACCCTAATCCACATCCAACAAAT-BHQ1
    P M6FAM-AACGCCCTAATCCGCATCCAACGA-BHQ1
HIN1
    R1GTTTGTTAAGAGGAAGTTTTCCGAAACATACAAAACAAAACCAC
    R2 UMAAGTTTTTGAGGTTTGGGTAGGGAACCAACCTCACCCACACTCCTA
    R2 MTAGGGAAGGGGGTACGGGTTTCGCTCACGACCGTACCCTAA
    P UMHEX-CAACTTCCTACTACAACCAACAAACC-BHQ1
    P M6FAM-ACTTCCTACTACGACCGACGAACC-BHQ1
RASSF1A
    R1GTTTTATAGTTTTTGTATTTAGGAACTCAATAAACTCAAACTCCC
    R2 UMGGTGTTGAAGTTGGGGTTTGCCCATACTTCACTAACTTTAAAC
    R2 MGCGTTGAAGTCGGGGTTCCCCGTACTTCGCTAACTTTAAACG
    P UMHEX-CTAACAAACACAAACCAAACAAAACCA-BHQ1
    P M6FAM-ACAAACGCGAACCGAACGAAACCA-BHQ1
RAR-β2
    R1GTAGGAGGGTTTATTTTTTGTTAATTACATTTTCCAAACTTACTC
    R2 UMTTGAGAATGTGAGTGATTTGAGTAGTTACAAAAAACCTTCCAAATACATTC
    R2 MAGAACGCGAGCGATTCGAGTAGTACAAAAAACCTTCCGAATACGTT
    P UMHEX-AAATCCTACCCCAACAATACCCAAAC-BHQ1
    P M6FAM-ATCCTACCCCGACGATACCCAAAC-BHQ1
  • Abbreviations: R1, first-round multiplex; R2 UM, second-round uniplex unmethylated; R2 M, second-round uniplex methylated; P UM, probe for unmethylated; P M, probe for methylated.