Table 2.

Primers and conditions for PCR

SNPDbSNP IDSNP regionAmino acid changePCR and pyrosequencing primersPCR conditions
A1298Crs1801131Ex8-62A>CE429ABiotinylated 5′-7AGGAGGAGCTGCGAAGATG (F)Denaturing at 95°C for 6 min
5′-CCCCACTCCAGCATCACTCA (R)45 cycles of 95°C for 15 s
5′-AACAAAGACTTCAAAGACAC (S)62°C for 30 s
C677Trs1801133Ex5+79C>TA222VBiotinylated 5′-7ATCCCTCGCCTTGAACAGGT (F)72°C for 15 s
5′-TCGGTGCATGCCTTCCACAA (R)Extension at 72°C for 6 min
5′-CGTGATGATGAAATCG (S)
  • Abbreviations: F, forward; R, reverse; S, sequencing.