Table 2.

Oligonucleotide sequences for primers used for DNA sequencing, RFLP, allelic discrimination PCR, Sequenom, and Taqman SNP Genotyping Assay

Primer5′ PositionSequence3′ Position
Sequencing
    2677Cfor65436GCTATAGGTTCCAGGCTTGCT65416
    MDR1rev65140TAGAGCATAGTAAGCAGTAGG65161
RFLP
    MDR1 forward65304TGCAATAGCAGGAGTTGT65287
    MDR1 reverse64964AAAGTGGGGAGGAAGGAAGA64983
Allelic discrimination
    2677W65221AGTTTGACTCACCTTCCCTGC65241
    2677M65221AGTTTGACTCACCTTCCCTGA65241
Taqman primer
    Forward65461GTCTTGGACAAGCACTGAAAGATAAGA65435
    Reverse65186CATATTTAGTTTGACTCA65232
    Probe 165233VIC- CTTCCCAGAACCTTC-NFQMGB65247
    Probe 265235FAM- TCCCAGCACCTTC-NFQMGB65247
LightCycler primer
    MDR1 ex21S forward65297GCAGGAGTTGTTGAAATGAAAATG65274
    MDR1 ex21B reverse65218cgcctgc TTTAGTTTGACTCA65232
    21 Anchor65253CTTTCTTATCTTTCAGTGCTTGTCC65276
    21 Sensor65248TTCCCAGTACCTTCT65235
Sequenom primer
    MDR1 PCR forward65290ACGTTGGATGGAAAATGTTGTCTGGACAAGC65270
    MDR1 PCR reverse65214ACGTTGGATGCATATTTAGTTTGACTCACC65233
    MDR1 UEP_SEQ65262ggcGATAAGAAAGAACTAGAAGGT65240
    MDR1 EXT1_SEQ65262ggcGATAAGAAAGAACTAGAAGGTC65241
    MDR1 EXT2_SEQ65262ggcGATAAGAAAGAACTAGAAGGTA65241
    MDR1 EXT3_SEQ65262ggcGATAAGAAAGAACTAGAAGGTG65241
    MDR1 EXT4_SEQ65262ggcGATAAGAAAGAACTAGAAGGTT65241
  • NOTE: Primers were designed on the published MDR1 sequence (AC005068) or adopted from Song et al. (53).

    Abbreviations: NFQ-MGB, non-fluorescent quencher/minor groove binder; VIC, fluorescent dye used to label the Taqman SNP Genotyping Assay probe that detects the allele 1 sequence; FAM, fluorescent dye used to label the Taqman SNP Genotyping Assay probe that detects the allele 2 sequence; UEP, unextended primer; EXT1, EXT2, EXT3, EXT4, mass extent primer.