Table 1.

MethyLight primer and probe sequences

GeneForward primer (5′-3′)Probe (5′-3′)Reverse primer (5′-3′)
ACTBNBK105NBK260NBK106
TGGTGATGGAGGAGGTTTAGTAAGT6FAM-ACCACCACCCAACACACAATAACAAACACA-TAMRAAACCAATAAAACCTACTCCTCCCTTAA
DAPK1NBK195NBK186NBK196
GGAGAGGGTGGTTACGGTGTT6FAM-CAACCTACGACAACGATAA-MGBACCCTCGCCCAAACGATAC
RARBNBK197NBK187NBK198
TGAGGATTGGGATGTCGAGAA6FAM-CTACTCGAATCGCTCG-MGBCCCGACGATACCCAAACAAA
TWIST1NBK285NBK286NBK287
GCGCGGCGAACGTTT6FAM-CAACGCACCCAATCG-MGBCGAATCATAACCAACGTACGAAAA
CDH13NBK225NBK219NBK226
GATTTTTGGGTTCGGAATGATTT6FAM-TTTTCGTCGTCGCGATC-MGBATCGCCCGACACGAACAA