Table 1.

Primer and probe sequences for the UGT2B17 genotype assay

Primer namePrimer composition (5′-3′)
Exon 1 (forward)TGAAAATGTTCGATAGATGGACATATAGTA
Exon 1 (reverse)GACATCAAATTTTGACTCTTGTAGTTTTC
Exon 1 (probe)6-FAM-TACATTTTGGTCATATTTTTCACAACTACAAGAATTGT-BHQ1
Deletion (forward)TTTAATGTTTTCTGCCTTATGCCAC
Deletion (reverse)AGCCTATGCAATTTTCATTCAACATAG
Deletion (probe)JOE-ACTACACTGAGATTTACAAAAGAATTCTGTCAGGATATAG-BHQ1