Table 1.

PCR-based Taqman genotyping assay conditions for polymorphisms in DSB repair genes

LocusSNPDatabase for SNP reference sequence no.Forward/reverse primersProbe sequences,* VIC/FAM probesAnnealing temperature (°C)
XRCC3Nucleotide 18067 C→T Thr241Metrs861539CCAGGCATCTGCAGTCCC/ACAGCACAGGGCTCTGGAAThr241 (C) VIC-TCACGCAGCgTGGCCCC/Met241 (T) FAM-CACGCAGCaTGGCCCCC62.0
NBS1Nucleotide 11122 G→C Glu185Glnrs1805794TTCAATTTGTGGAGGCTGCTT/GACGTCCAATTGTAAAGCCCAGAATAGln185 (C) VIC-AGCAGTTcAGTCCAA/Glu185 (G) FAM-AGCAGTTgAGTCCAA60.0
XRCC2Nucleotide 31279 G→A Arg188Hisrs3218536TGTTCTCAGTGCTTAGAGAAGCTTGT/GCATTATAGTTTGTGTCGTTGCAAAArg188 (G) VIC-ATGACTATCgCCTGGTT/His188 (A) FAM-ATGACTATCaCCTGGTTC60.0
BRCA2Nucleotide 1342 A→C Asn372Hisrs144848AACCAAATGATACTGATCCATTAGATTC/GAGATTTTGTCACTTCCACTCTCAAAAsn372 (A) VIC-AAATGTAGCAaATCAGAAG/His372 (C) FAM-AAATGTAGCAcATCAGAA60.0
  • * Lowercase bases indicate sequence variants. NBS1, XRCC2, and BRCA2 were minor groove binding probes designed for the antisense strand.