Table 2.

Primer sequences and annealing temperatures for the analysis of methylation at the indicated CpG islands using MSP

GeneMSP reactionPrimer sequencesAnnealing temperature (°C)Reference
APCU-FGTGTTTTATTGTGGAGTGTGGGGTT66Esteller et al. (11)
U-RCCAATCAACAAACTCCCAACAA
M-FTATTGCGGAGTGCGGGTC69
M-RTCGACGAACTCCCGACGA
HPP1U-FGTAGTTTTTTGTGTTTTTGGTGT64
U-RCAAAACATCCCACAAACAACAA
M-FGTTTTTCGCGTTTTCGGCGT72.5
M-RATCATCCCGCGAACGACGA
MLH1U-FTTAATAGGAAGAGTGGATAGTG57Ueki et al. (28)
U-RTCTATAAATTACTAAATCTCTTCA
M-FTTAATAGGAAGAGCGGATAGC60.5
M-RCTATAAATTACTAAATCTCTTCG
MGMTU-FTTTGTGTTTTGATGTTTGTAGGTTTTTGT65Esteller et al. (27)
U-RAACTCCACACTCTTCCAAAAACAAAACA
M-FTTTCGACGTTCGTAGGTTTTCGC70
M-RGCACTCTTCCGAAAACGAAACG
p16INK4aU-FTTATTAGAGGGTGGGGTGGATTGT64Herman et al. (18)
U-RCAACCCCAAACCACAACCATAA
M-FTTATTAGAGGGTGGGGCGGATCGC77.5
M-RGACCCCCGAACCGCGACCGTAA
  • NOTE: Abbreviations: U, unmethylated; M, methylated; F, forward; R, reverse.