Table 1.

Primer sequences for the amplification of CpG islands from bisulfite-modified DNA by PCR together with their annealing temperatures

GeneGenbank accession No.Primer sequencesAnnealing temperature (°C)Restriction enzyme (Cuts at)
APCU02509, D13980GTTAGGGTTAGGTAGGTTGT59.5ClaI (166)
CCATAATAACTCCAACACCTA
HPP1AF264150AGAGTTTTTTTTTTATGGTAGTAGT56TaqI (108)
ACTCCCACAACACCATAACTA
MLH1U83845TTAGATTATTTTAGTAGAGGTATATAAG53AflIII (123)
ATACCTTCAACCAATCACCTCAATA
ESR1AL356311ATGGTTTTATTGTATTAGATTTAAGGGAA58Sau3AI (195), TaqI (132, 281)
AAACTCRTTCTCCAAATAATAAAACACCTA
MGMTgi∣10944181GTTTYGGATATGTTGGGATAGTT58TaqI (48)
CTACAAACCACTCRAAACTACCA
p16INK4aAF527803GGTTTTTTTTAGAGGATTTGAGGGATA62Sau3AI (100)
AAACAAACCCTCTACCCACCTAA
  • NOTE: Methylation at each locus was determined by COBRA assay using the indicated restriction enzyme.