Influence of Methylenetetrahydrofolate Reductase Gene Polymorphisms C677T and A1298C on Age-Associated Risk for Colorectal Cancer in a Caucasian Lynch Syndrome Population

DOI: 10.1158/1055-9965.EPI-07-0384 Published September 2007

Article Figures & Data

Download figure
Open in new tab
Download powerpoint
Figure 1.
Kaplan-Meier survival plots comparing time to onset of colorectal cancer according to the three MTHFR C677T genotypes CC, CT, and TT (A); according to CT+TT versus CC (B); and according to haplotypes C-A, C-C, and T-A, derived from C677T and A1298C (C). Haplotype T-C was omitted in (C) because it was present in only one subject.
Download figure
Open in new tab
Download powerpoint
Figure 2.
Kaplan-Meier survival plots comparing time to onset of colorectal cancer according to the three MTHFR C677T genotypes CC, CT, and TT stratified by the MMR gene mutated: MLH1 (A); MSH2 (B).

Table 1.

Demographic and genetic characteristics of the study population

		Colorectal cancer, n = 95	No colorectal cancer, n = 90	Total, N = 185 (%)
Gender
Male		55	34	89 (48.1)
Female		40	56	96 (51.9)
Age at onset* (y)
Mean (SD)		41.7 (11.0)	42.7 (11.8)	42.2 (11.4)
Median		40	42	41
Range		23-75	18-77	18-77
MMR gene mutated
MLH1		46	40	86 (46.5)
MSH2		49	50	99 (53.5)
MMR gene mutation type
Missense^†		21	19	40 (21.5)
Deletion/insertion/nonsense/splice		74	71	145 (74.4)
MTHFR
A1298C	AA	49	51	100 (54.0)
		AC	36	30	66 (35.7)
		CC	10	7	17 (9.2)
Unable to genotype				2 (1.1)
(Any C) AC+CC		46	37	83 (44.9)
C677T	CC	43	32	75 (40.5)
		CT	42	44	86 (46.5)
		TT	10	14	24 (13.0)
(Any T) CT+TT			52	58	110 (59.5)

↵* Age is mean age at colorectal cancer onset for individuals with colorectal cancer and mean age at censoring for unaffected MMR gene mutation carriers (subjects were censored at age at last blood draw or at last contact, or at diagnosis of colorectal adenoma or cancer other than colorectal cancer).
↵† These missense mutations were confirmed to be pathogenic mutations by a Clinical Laboratory Improvement Act–certified laboratory or from the International Collaborative Group-HNPCC InSiGHT database (48) or from the published literature (49, 50).

Table 2.

Primers and conditions for PCR

SNP	DbSNP ID	SNP region	Amino acid change	PCR and pyrosequencing primers	PCR conditions
A1298C	rs1801131	Ex8-62A>C	E429A	Biotinylated 5′-7AGGAGGAGCTGCGAAGATG (F)	Denaturing at 95°C for 6 min
						5′-CCCCACTCCAGCATCACTCA (R)	45 cycles of 95°C for 15 s
						5′-AACAAAGACTTCAAAGACAC (S)	62°C for 30 s
C677T	rs1801133	Ex5+79C>T	A222V	Biotinylated 5′-7ATCCCTCGCCTTGAACAGGT (F)	72°C for 15 s
						5′-TCGGTGCATGCCTTCCACAA (R)	Extension at 72°C for 6 min
						5′-CGTGATGATGAAATCG (S)

Table 3.

MTHFR genotype and colorectal cancer risk in MMR gene mutation carriers

NOTE: HRs are corrected for any familial correlation in ages of onset by applying robust variance correction.
↵* Adjusted for gender, MMR gene mutated, and MMR mutation type.
↵† Genotypes are listed in the following order: homozygous WT, heterozygous, and homozygous polymorphic.