Article Figures & Data
Figures
- Figure 1.
MDR1 G2677T/A allelic discrimination PCR by melting curve analysis using the LightCycler. A. Three common genotypes: T/T, G/T, and G/G. B. Genotypes T/T and G/G and the rare genotypes T/A or G/A, respectively.
Tables
- Table 1.
Known triallelic SNPs in IBD-associated genes as shown on the National Center for Biotechnology Information database
Gene rs no. Description as diallelic (year) Description of 3rd allele (year) MDR1 rs10274623 C/G (2003) C/G/T (2005) rs2032582 G/T (2001) A/G/T (2003) TNFRSF1B rs522205 A/T (2000) A/T/C (2003) OCTN2 rs11568513 — A/G/T (2003) DLG5 rs1866436 — C/G/T (2001) IL4 rs2243244 — A/G/T (2001) IL11 rs4252546 — A/C/G (2002) MIF rs2330659 A/C (2001) A/C/G (2002) rs2330658 A/T (2001) A/C/G (2002) NFkB1 rs12721575 G/T (2002) A/G/T (2004) rs3810903 — A/G/T (2003) - Table 2.
Oligonucleotide sequences for primers used for DNA sequencing, RFLP, allelic discrimination PCR, Sequenom, and Taqman SNP Genotyping Assay
Primer 5′ Position Sequence 3′ Position Sequencing 2677Cfor 65436 GCTATAGGTTCCAGGCTTGCT 65416 MDR1rev 65140 TAGAGCATAGTAAGCAGTAGG 65161 RFLP MDR1 forward 65304 TGCAATAGCAGGAGTTGT 65287 MDR1 reverse 64964 AAAGTGGGGAGGAAGGAAGA 64983 Allelic discrimination 2677W 65221 AGTTTGACTCACCTTCCCTGC 65241 2677M 65221 AGTTTGACTCACCTTCCCTGA 65241 Taqman primer Forward 65461 GTCTTGGACAAGCACTGAAAGATAAGA 65435 Reverse 65186 CATATTTAGTTTGACTCA 65232 Probe 1 65233 VIC- CTTCCCAGAACCTTC-NFQMGB 65247 Probe 2 65235 FAM- TCCCAGCACCTTC-NFQMGB 65247 LightCycler primer MDR1 ex21S forward 65297 GCAGGAGTTGTTGAAATGAAAATG 65274 MDR1 ex21B reverse 65218 cgcctgc TTTAGTTTGACTCA 65232 21 Anchor 65253 CTTTCTTATCTTTCAGTGCTTGTCC 65276 21 Sensor 65248 TTCCCAGTACCTTCT 65235 Sequenom primer MDR1 PCR forward 65290 ACGTTGGATGGAAAATGTTGTCTGGACAAGC 65270 MDR1 PCR reverse 65214 ACGTTGGATGCATATTTAGTTTGACTCACC 65233 MDR1 UEP_SEQ 65262 ggcGATAAGAAAGAACTAGAAGGT 65240 MDR1 EXT1_SEQ 65262 ggcGATAAGAAAGAACTAGAAGGTC 65241 MDR1 EXT2_SEQ 65262 ggcGATAAGAAAGAACTAGAAGGTA 65241 MDR1 EXT3_SEQ 65262 ggcGATAAGAAAGAACTAGAAGGTG 65241 MDR1 EXT4_SEQ 65262 ggcGATAAGAAAGAACTAGAAGGTT 65241 NOTE: Primers were designed on the published MDR1 sequence (AC005068) or adopted from Song et al. (53).
Abbreviations: NFQ-MGB, non-fluorescent quencher/minor groove binder; VIC, fluorescent dye used to label the Taqman SNP Genotyping Assay probe that detects the allele 1 sequence; FAM, fluorescent dye used to label the Taqman SNP Genotyping Assay probe that detects the allele 2 sequence; UEP, unextended primer; EXT1, EXT2, EXT3, EXT4, mass extent primer.
- Table 3.
The observed genotype frequencies obtained using the different methods of analysis (see Materials and Methods)
Method (no. genotypes) Estimated allele frequency G T A PCR (69) 0.543 0.457 0.000 Taqman (71) 0.586 0.414 0.000 RFLP (73) 0.582 0.418 0.000 LightCycler (73) 0.589 0.377 0.034 Sequencing (69) 0.572 0.384 0.043 Sequenom (69) 0.565 0.391 0.043 True genotype frequency (73) 0.562 0.397 0.041 NOTE: The number of genotypes is <73 for some platforms due to failed or unclear assays (see Table 4).
- Table 4.
Error rates for Taqman, LightCycler, PCR, and RFLP
Method Genotype error (95% confidence interval) Allele error Comments Knowledge of 3rd allele not necessary Sequencing 0.014 (0.000, 0.078) 0.007 (0.000, 0.040) 1 error, 68 correct, 4 missing Sequenome 0.000 (0.000, 0.052) 0.000 (0.000, 0.026) 0 errors, 69 correct, 4 missing LightCycler 0.096 (0.039, 0.188) 0.062 (0.029, 0.114) 7 errors, 66 correct, 0 missing Knowledge of 3rd allele necessary Taqman 0.010 (0.041, 0.195) 0.050 (0.020, 0.100) 7 errors, 63 correct, 3 missing PCR 0.145 (0.072, 0.250) 0.072 (0.035, 0.129) 10 errors, 59 correct, 4 missing RFLP 0.110 (0.049, 0.205) 0.062 (0.029, 0.114) 8 errors, 65 correct, 0 missing NOTE: Genotype error rate was defined as the number of correct genotypes divided by the number of successful genotypes. Allele error rate is defined as number of correctly called alleles divided by twice the number of successful genotypes. A successful genotype is a genotype that is not missing and that is not unclear.
- Table 5.
Missing genotypes out of 73 attempted
Method Missing rate (95% confidence interval) Comments Missing alleles Knowledge of 3rd allele not necessary Sequencing 0.055 (0.015, 0.134) 4 missing G/T (4) Sequenome 0.055 (0.015, 0.134) 4 missing G/G (2), T/T (2) LightCycler 0.000 (0.000, 0.049) 0 missing Knowledge of 3rd allele necessary Taqman 0.041 (0.009, 0.115) 3 missing G/T (2), T/T (1) PCR 0.055 (0.015, 0.134) 4 missing G/T (2), G/G (2) RFLP 0.000 (0.000, 0.049) 0 missing NOTE: Failed and unclear genotypes counts were combined to obtain missing genotype counts.
- Table 6.
Summary of MDR1 G2677/T/A allele frequencies reported in various studies
Study n Racial group Methods Allele frequencies G T A Healthy population Cascorbi et al. 2001 461 (167 ♀, 294 ♂) German RFLP and sequencing 0.564 0.416 0.019 Kurzawski et al. 2006 204 (♀ 93, ♂ 111) Polish-Caucasian Allele-specific PCR and sequencing 0.595 0.385 0.020 Gaikovitch et al. 2003 290 (healthy or non malignant disease) Russian-Caucasian Hybridization probe 0.548 0.419 0.033 Allabi et al. 2005 111 West African (Beninese) 2× sequencing 0.991 0.009 0 Cavaco et al. 2003 100 Caucasian Portuguese PCR-RFLP 0.525 0.475 — Tan et al. 2004 104 Chinese Sequencing 0.505 0.437 0.058 139 Polish Caucasians 0.576 0.414 0.011 Tang et al. 2002 104 Chinese RFLP 0.505 0.437 0.058 93 Malay 0.575 0.360 0.065 68 Indian 0.338 0.618 0.044 Lee et al. 2005 632 Koreans Pyrosequencing 0.438 0.391 0.171 142 Vietnamese 0.581 0.356 0.063 Horinouchi et al. 2002 117 Japanese PCR-RFLP and sequencing 0.440 0.360 0.200 Saito et al. 2003 130 (♀ 70, ♂ 60) Japanese Taqman and direct sequencing? 0.432 0.408 0.169 IBD studies Urcelay et al. 2006 321 CD Spanish PCR and sequencing 0.632 0.359 0.009 330 UC 0.628 0.365 0.007 352 controls 0.605 0.384 0.011 Potocnik et al. 2004 139 CD Slovenian Taqman 0.595 0.405 — 144 UC 0.520 0.480 — 355 controls 0.597 0.403 — Onnie et al. 2006 828 CD British (Jewish and non-Jewish) Pyrosequencing and partial sequencing (48 samples) 0.579 0.405 0.016 580 UC 0.533 0.446 0.021 285 controls 0.579 0.396 0.025 Ho et al. 2005 335 UC patients Scottish Taqman (only G/T) and sequencing (100) for A allele frequency 0.546 0.498 0.02 268 CD patients 0.528 0.472 — 370 controls 0.512 0.498 — Palmieri et al. 2005 478 CD patients Italian Sequencing 0.559 0.425 0.016 468 UC patients 0.528 0.447 0.025 450 controls 0.556 0.423 0.021 Brant et al. 2003 211 non-Jewish IBD 65% non-Jewish 0.602 NJP 0.393 NJP 0.005 NJP 392 non-Jewish controls 0.524 NJC 0.45 NJC 0.026 NJC 114 Jewish IBD PCR-sequencing and pyrosequencing 0.627 JP 0.368 JP 0.005 JP 219 White Ashkenazi Jewish controls 35% Jewish ancestry 0.605 JC 0.365 JC 0.003 JC NOTE: ♀, male; ♂, female.
Abbreviations: CD, Crohn's disease; UC, ulcerative colitis; NJP, non-Jewish IBD patients; NJC, non-Jewish controls; JP, Jewish IBD patients; JC, white Ashkenazi Jewish controls.
Volume 16, Issue 6
