Skip to main content
  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

AACR logo

  • Register
  • Log in
  • My Cart
Advertisement

Main menu

  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • CEBP Focus Archive
    • Meeting Abstracts
    • Progress and Priorities
    • Collections
      • COVID-19 & Cancer Resource Center
      • Disparities Collection
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Informing Public Health Policy
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

User menu

  • Register
  • Log in
  • My Cart

Search

  • Advanced search
Cancer Epidemiology, Biomarkers & Prevention
Cancer Epidemiology, Biomarkers & Prevention
  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • CEBP Focus Archive
    • Meeting Abstracts
    • Progress and Priorities
    • Collections
      • COVID-19 & Cancer Resource Center
      • Disparities Collection
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Informing Public Health Policy
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citation
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

Research Articles

The UDP-Glucuronosyltransferase 2B17 Gene Deletion Polymorphism: Sex-Specific Association with Urinary 4-(Methylnitrosamino)-1-(3-Pyridyl)-1-Butanol Glucuronidation Phenotype and Risk for Lung Cancer

Carla J. Gallagher, Joshua E. Muscat, Amy N. Hicks, Yan Zheng, Anne-Marie Dyer, Gary A. Chase, John Richie and Philip Lazarus
Carla J. Gallagher
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Joshua E. Muscat
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Amy N. Hicks
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yan Zheng
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Anne-Marie Dyer
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Gary A. Chase
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
John Richie
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Philip Lazarus
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1158/1055-9965.EPI-06-0823 Published April 2007
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Figure 1.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 1.

    Gene structure and primer and probe locations for the UGT2B17 multiplex real-time PCR assay. I to VI, exons of the UGT2B17 gene on the wild-type allele. The deletion allele is shown below the wild-type allele, indicating that the 120 kb are deleted including the entire UGT2B17 gene. Dashed arrows, primers that will amplify the deletion allele; dashed line (with fluorescent label Joe), deletion probe. Solid arrows, primers that will amplify exon 1 of UGT2B17 from the wild-type allele; solid line (with fluorescent label Fam), deletion probe.

  • Figure 2.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 2.

    Urinary NNAL glucuronidation rates grouped by UGT2B17 deletion genotype. Urinary NNAL glucuronidation rates are indicated by the ratio of NNAL-Gluc/NNAL for 82 non-Hispanic White smokers (A). Results stratified by sex are shown for 41 females (B) and 41 males (C). Points, mean; bars, SE. Significant (all subjects; *, P = 0.049) or near-significant (women only; **, P = 0.058) associations were observed comparing the NNAL-Gluc/NNAL ratios in subjects with the UGT2B17 (0/0) genotype versus subjects with the UGT2B17 (+/+) or (+/0) genotype as determined by Student's t test.

Tables

  • Figures
  • Table 1.

    Primer and probe sequences for the UGT2B17 genotype assay

    Primer namePrimer composition (5′-3′)
    Exon 1 (forward)TGAAAATGTTCGATAGATGGACATATAGTA
    Exon 1 (reverse)GACATCAAATTTTGACTCTTGTAGTTTTC
    Exon 1 (probe)6-FAM-TACATTTTGGTCATATTTTTCACAACTACAAGAATTGT-BHQ1
    Deletion (forward)TTTAATGTTTTCTGCCTTATGCCAC
    Deletion (reverse)AGCCTATGCAATTTTCATTCAACATAG
    Deletion (probe)JOE-ACTACACTGAGATTTACAAAAGAATTCTGTCAGGATATAG-BHQ1
  • Table 2.

    Age, sex, BMI, smoking status, education level, and case histology of 398 lung cancer cases and 697 controls

    Cases [n (%)]Controls [n (%)]P
    Mean age*64.1 ± 9.958.3 ± 10.3<0.01
    Women (%)175 (44)324 (46)0.42
    Mean BMI*26.8 ± 5.027.3 ± 4.9<0.01
    Smoking status (%)
        Never smokers35 (9)268 (38)<0.01
        Former smokers205 (52)291 (42)
        Current smokers108 (40)138 (20)
    Pack-years*56.0 ± 38.923.5 ± 30.7<0.01
    Years of education (%)
        <High school degree63 (16)30 (4)<0.01
        High school degree246 (62)392 (56)
        College degree59 (15)167 (24)
        Postgraduate degree30 (8)108 (15)
    Histology (%)
        Adenocarcinoma151 (38)
        Squamous cell carcinoma100 (27)
        Non–small-cell carcinoma69 (17)
        Small-cell carcinoma39 (10)
        Large-cell carcinoma24 (6)
        Mixed histology/other15 (4)
    • ↵* Mean ± SD.

  • Table 3.

    Distribution of genotypes by sex and risk of lung cancer

    UGT2B17 genotypeCases (%)Controls (%)OR (95% CI)*
    Men
        (+/+)121 (54)176 (47)Reference
        (+/0)83 (37)156 (42)0.7 (0.4-1.1)
        (0/0)19 (9)41 (11)0.7 (0.4-1.5)
        (+/+) + (+/0)204 (91)332 (89)Reference
        (0/0)19 (9)41 (11)0.9 (0.4-1.7)
    Women
        (+/+)91 (52)161 (50)Reference
        (+/0)58 (33)131 (40)0.8 (0.5-1.3)
        (0/0)26 (15)32 (10)1.8 (0.9-3.7)
        (+/+) + (+/0)149 (85)292 (90)Reference
        (0/0)26 (15)32 (10)2.0 (1.01-4.0)
    • ↵* OR and 95% CI adjusted for age, BMI, education level, and pack-years.

  • Table 4.

    Distribution of UGT2B17 genotypes by sex and risk of lung adenocarcinoma

    UGT2B17 genotypeCases (%)Controls (%)OR (95% CI)*
    Men
        (+/+)36 (52)176 (47)Reference
        (+/0)26 (37)156 (42)0.7 (0.4-1.3)
        (0/0)8 (11)41 (11)0.9 (0.4-2.3)
        (+/+) + (+/0)62 (89)332 (89)Reference
        (0/0)8 (11)41 (11)1.0 (0.4-2.3)
    Women
        (+/+)40 (49)161 (50)Reference
        (+/0)26 (32)131 (40)0.7 (0.4-1.4)
        (0/0)15 (19)32 (10)2.4 (1.01-5.7)
        (+/+) + (+/0)66 (81)292 (90)Reference
        (0/0)15 (19)32 (10)2.8 (1.2-6.3)
    • ↵* OR and 95% CI adjusted for age, BMI, education level, and pack-years.

PreviousNext
Back to top
Cancer Epidemiology Biomarkers & Prevention: 16 (4)
April 2007
Volume 16, Issue 4
  • Table of Contents
  • Table of Contents (PDF)

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for sharing this Cancer Epidemiology, Biomarkers & Prevention article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
The UDP-Glucuronosyltransferase 2B17 Gene Deletion Polymorphism: Sex-Specific Association with Urinary 4-(Methylnitrosamino)-1-(3-Pyridyl)-1-Butanol Glucuronidation Phenotype and Risk for Lung Cancer
(Your Name) has forwarded a page to you from Cancer Epidemiology, Biomarkers & Prevention
(Your Name) thought you would be interested in this article in Cancer Epidemiology, Biomarkers & Prevention.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
The UDP-Glucuronosyltransferase 2B17 Gene Deletion Polymorphism: Sex-Specific Association with Urinary 4-(Methylnitrosamino)-1-(3-Pyridyl)-1-Butanol Glucuronidation Phenotype and Risk for Lung Cancer
Carla J. Gallagher, Joshua E. Muscat, Amy N. Hicks, Yan Zheng, Anne-Marie Dyer, Gary A. Chase, John Richie and Philip Lazarus
Cancer Epidemiol Biomarkers Prev April 1 2007 (16) (4) 823-828; DOI: 10.1158/1055-9965.EPI-06-0823

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
The UDP-Glucuronosyltransferase 2B17 Gene Deletion Polymorphism: Sex-Specific Association with Urinary 4-(Methylnitrosamino)-1-(3-Pyridyl)-1-Butanol Glucuronidation Phenotype and Risk for Lung Cancer
Carla J. Gallagher, Joshua E. Muscat, Amy N. Hicks, Yan Zheng, Anne-Marie Dyer, Gary A. Chase, John Richie and Philip Lazarus
Cancer Epidemiol Biomarkers Prev April 1 2007 (16) (4) 823-828; DOI: 10.1158/1055-9965.EPI-06-0823
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF
Advertisement

Related Articles

Cited By...

More in this TOC Section

  • Urinary Melatonin in Relation to Breast Cancer Risk
  • Endometrial Cancer and Ovarian Cancer Cross-Cancer GWAS
  • Risk Factors of Subsequent CNS Tumor after Pediatric Cancer
Show more Research Articles
  • Home
  • Alerts
  • Feedback
  • Privacy Policy
Facebook   Twitter   LinkedIn   YouTube   RSS

Articles

  • Online First
  • Current Issue
  • Past Issues

Info for

  • Authors
  • Subscribers
  • Advertisers
  • Librarians

About Cancer Epidemiology, Biomarkers & Prevention

  • About the Journal
  • Editorial Board
  • Permissions
  • Submit a Manuscript
AACR logo

Copyright © 2021 by the American Association for Cancer Research.

Cancer Epidemiology, Biomarkers & Prevention
eISSN: 1538-7755
ISSN: 1055-9965

Advertisement