Table 1.

Gene resequencing results and predicted coding changes

GeneVariantFrequencyaAmino acid changeSIFTPolyphendbSNP ID (build 137)Flanking sequence
CTNNA1IVS4 (+45) A/G1/44 (0.02)N/AN/AN/Ars28363396ttaaagttgttcattttact[A/G]tctagagggaaaaactcatt
IVS7 (+8) C/G16/44 (0.36)N/AN/AN/Ars288028CTTGCGTAGACAGgtaatct[C/G]gatgaaagtgctgattgttt
x15 (2220) G/A16/44 (0.36)SilentN/AN/Ars1059110GGACCACTCAAAAATACATC[G/A]GATGTCATCAGTGCTGCCAA
x15 (2226) C/G1/44 (0.02)SilentN/AN/Ars11552052CTCAAAAATACATCGGATGT[C/G]ATCAGTGCTGCCAAGAAAAT
CTNNB1IVS14 (-17) T/G1/44 (0.02)N/AN/AN/Actttctattcttccttgctt[T/G]gtgcatgtttatctagACTG
x16 (2452) C/T1/44 (0.02)SilentN/AN/Ars4135386CTCCAGGTGACAGCAATCAG[C/T]TGGCCTGGTTTGATACTGAC
JUPx3 (213) T/C36/44 (0.82)SilentN/AN/Ars7405731GTGCCCCCCAGCCAAGGTGA[T/C]CTGGAGTACCAGATGTCCAC
x3 (431) G/A1/44 (0.02)Arg144HisToleratedPossibly damagingCGATGCCGAGCTGGCCACTC[G/A]CGCCCTGCCCGAGCTCACCA
x4 (532) C/T1/44 (0.02)Arg178TrpNot toleratedProbably damagingTGTCGAAGAAGGAGGCGTCG[C/T]GGCGGGCCCTGATGGGCTCG
IVS5 (+17) T/C7/44 (0.16)N/AN/AN/Ars12942034CAAGgtgggccctccccaac[T/C]ctcccgaggcctgaagccca
x6 (964) G/A1/44 (0.02)Val322MetToleratedBenignATGGTGGGCCCCAGGCCCTC[G/A]TGCAGATCATGCGTAACTAC
IVS10 (−34) C/A30/44 (0.68)N/AN/AN/Agcctgcctcacccctttcca[C/A]ctctcccctgcttcccacgt
IVS12 (+22) A/G30/44 (0.68)N/AN/AN/Ars7216034tgagtatcctaggttggacc[A/G]cagtagttggttgtgcaagt
x14 (2108) A/T30/44 (0.68)SilentN/AN/AATGAGCCCTATGGAGATGAC[A/T]TGGATGCCACCTACCGCCCC
CTNND1x3 (24) G/C1/44 (0.02)SilentN/AN/AGACGACTCAGAGGTGGAGTC[G/C]ACCGCCAGCATCTTGGCCTC
x6 (483) C/T1/44 (0.02)SilentN/AN/Ars10896644CCAGTCGCTATGGGACCAGA[C/T]GGGTTGCCTGTGGATGCTTC
IVS20 (−45) A/G2/44 (0.05)N/AN/AN/Aagctctggcacacactcatg[A/G]ggttcctgtctctactcata
  • aNumber of times variant was observed/number of chromosomes examined (frequency).