Table 1.

Sequences of the primers used for qPCR

Sequence no.GeneSequence (5′ → 3′)Primer lengthGenBank accession no.*Amplicon length
1IGFBP2_FGACAATGGCGATGACCACTCA21NM_000597.2 (571-691)
IGFBP2_RGCTCCTTCATACCCGACTTGA21120
2IGFBP3_FAGAGCACAGATACCCAGAACT21BC064987 (694-798)
IGFBP3_RTGAGGAACTTCAGGTGATTCAGT23104
3IGFBP5_FCGGGGTTTGCCTCAACGAA19NM_000599 (1064-1180)
IGFBP5_RTCTTGGGGGAGTAGGTCTCCT21116
4RPL35a_FACGCCCGAGATGAAACAG18BC017093 (209-428)
RPL35a_RGGGTACAGCATCACTCGGA19219
5AGPAT1_FTGTCCCCATAGTCATGTCCTC21NM_006411.2 (933-1105)
AGPAT1_RGGAAAACAGTGAGCATGGAGT21172
6ATP5G1_FCCAGACGGGAGTTCCAGAC19NM_005175.2 (283-440)
ATP5G1_RGACGGGTTCCTGGCATAGC19157
7GARS_FTCCTCTGTTTGAAGGGCAAG20NM_002047.1 (2525-2710)
GARS_RAAATCAGGCAGCCACTGAAG20185
  • *Numbers in parentheses denote the position of the amplicon in the GenBank sequence.

  • Intraexonic.

  • Interexonic.