Table 2.

Primers used in this study

GenePrimerPrimer sequence (5′→3′)Product size (bp)Annealing temperature (°C)Note*
BMP3UnmethylatedTTTAGTGTTGGAGTGGAGATGGTGTTTG14660
AAACACAACCAAATACAACAAAATAACAA
MethylatedTTTAGCGTTGGAGTGGAGACGGCGTTC14368
CGCGACCGAATACAACGAAATAACGA
Real-time MSPAATATTCGGGTTATATACGTCGC8762
CCTCACCCGCGCAAAACG
6FAM-TAGCGTTGGAGTGGAGACGGCGTTCG-TAMRA
Bisulfite sequencingGAGGAGGGAAGGTATAGATAGA25660
AATTAAACTCCAAACCAACTAAAAC
RT-PCRCCCAAGTCCTTTGATGCCTA14762
TGGTACACAGCAAGGCTCAG
EYA2UnmethylatedGGGAGGAGAAGGGGTTGGTTTTTTTG20960
CCTAAAATAAACACCACTAACAATACTCACCA
MethylatedTTTCGGCGTAGGTAGTAGTCGC19066
GACCTAAAATAAACGCCGCTAACGA
Real-time MSPTTTTCGGCGTAGGTAGTAGTC9762
GACGAAACCGAACTAACTACGA
6FAM-CGGTAACGGTAGAGATAGTAACGTGTTC-TAMRA
Bisulfite sequencingGGTTTAGGGAGGAGAAGGGGT37060
CCTCTACCCTTATACCTTCCTAAC
RT-PCRGGACAATGAGATTGAGCGTGT9060Ref. (57)
ATGTCCCCGTGAGTAAGGAGT
ALX4UnmethylatedTGTGTTTTTTATTGTGAGTTGTTGGTT29560
ACAACAACAACTAAAACTACAAAATCAAC
MethylatedTGCGTTTTTTATTGCGAGTCGTCGGTC29368
GACGACGACTAAAACTACGAAATCGACGA
Real-time MSPTTGTAGAGGTTTCGTTTTTCGTC13262
GCCTAAATTTCCCGTAAACTTTCGA
6FAM-CGTCGTCGTAGGTGAGAGCGTCGT-TAMRA
Bisulfite sequencingGGATAGTAGGATTGTAGAGGT18860
CTAAAACCCTAAAATCTCTAACTC
RT-PCRAGACCCACTACCCAGACGTG22263
GCCAGGACGGGTTCTGAAT
VimentinUnmethylatedTTGGTGGATTTTTTGTTGGTTGATG18860
CACAACTTACCTTAACCCTTAAACTACTCA
MethylatedTCGTTTCGAGGTTTTCGCGTTAGAGAC21668Ref. (9)
CGACTAAAACTCGACCGACTCGCGA
Real-time MSPGTTTTAGTCGGAGTTACGTGATTAC9762
GAAAACGAAACGTAAAAACTACGA
6FAM-CGTATTTATAGTTTGGGCGACGCGTTGC-TAMRA
Bisulfite sequencingGTAGTTATGTTTATTAGGTT34255
CATTCAACTCCTACAACTC
RT-PCRGGACCAGCTAACCAACGACA24760
CTGGATTTCCTCTTCGTGGA
β-actinReal-time bisulfite PCRTGGTGATGGAGGAGGTTTAGTAAGTUnknown62Ref. (31)
AACCAATAAAACCTACTCCTCCCTTAA
6FAM-ACCACCACCCAACACACAATAACAAACACA-TAMRA
GAPDHRT-PCRCATCACCATCTTCCAGGAGCG44260Ref. (50)
TGACCTTGCCCACAGCCTTG
K-rasPCRAAGGCCTGCTGAAAATGACTGAAT17964
CTGTATCAAAGAATGGTCCTGCACC
BRAFPCRCCACAAAATGGATCCAGACA17360
TGCTTGCTCTGATAGGAAAATG
  • Abbreviation: GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

  • * Oligos were designed by us except those with references.