Table 1

Summary of polymorphisms of the 11 candidate genes, including method of DNA analysis and upstream/downstream primers used

GenePolymorphismMethodPrimersReference
UpstreamDownstream
Androgen receptor CAG repeatDirect sequencingGTGGAAGATTCAGCCAAGCTTTGCTGTTCCTCATCCAGGA 19
SRD5A2 V89LRFLPCGCCTGGTTCCTGCAGGAGCTGTGAAGGCGGCGTCTGTG 15
CYP17 Single nucleotide base change T/CRFLPCATTCGCACCTCTGGAGTCGGCTCTTGGGGTACTTG 23
CYP3A4 NFSEaCSGEAACAGGGGTGGAAACACACTTTCCTGCCCTGCACAG 17
Vitamin D receptor BsmI (intron 8)RFLPCAACCAAGACTACAAGTACGCGTCAGTGAAACCAGCGGGAAGAGGTCAAGGG 25
PSA Single bp change G/ARFLPTTGTATGAAGAATCGGGGATCGTTCCCCCAGGAGCCCTATAAAA 28
GST-T1 Homozygous deletionRFLPTTCCTTACTGGTCCTCACATCTCACCGGATCATGGCCAGCA 36
GST-M1 Homozygous deletionRFLPCTGCCCTACTTGATTGATGGGCTGGATTGTAGCAGATCATGC 36
GST-P1 Single bp change I/VRFLPCAACTTCATCCACGTTCACCGAAGAGCCAAGGACAGTT 32
IGF-I 19-repeat alleleVNTRGCTAGCCAGCTGGTGTTATTACCACTCTGGGAGAAGGGTA 39
IGFBP-3 Single bp change A/CRFLPCCACGAGGTACACACGAATGAGCCGCAGTGCTCGCATCTGG 39
  • a NFSE, nifedipine specific element; CSGE, conformation-sensitive gel electrophoresis; VNTR, variable number of tandem repeats.