CEBP Infection and Cancer: Biology, Therapeutics, and Prevention Cancer Health Disparities Conference 2009
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ulrich, C. M.
Right arrow Articles by Potter, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ulrich, C. M.
Right arrow Articles by Potter, J. D.
Cancer Epidemiology Biomarkers & Prevention Vol. 9, 1381-1385, December 2000
© 2000 American Association for Cancer Research


Short Communications

Searching Expressed Sequence Tag Databases: Discovery and Confirmation of a Common Polymorphism in the Thymidylate Synthase Gene1

Cornelia M. Ulrich2, Jeannette Bigler, Christine M. Velicer, Elizabeth A. Greene, Federico M. Farin and John D. Potter

Cancer Prevention Research Program [C. M. U., J. B., C. M. V., J. D. P.] and Biocomputing Shared Resource [E. A. G.], Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, and Department of Epidemiology [C. M. U., C. M. V., J. D. P.] and Department of Environmental Health, Center for Ecogenetics and Environmental Health [F. M. F.], University of Washington, Seattle, Washington 98195


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Databases of expressed sequence tags (EST) can be used to screen rapidly for potential polymorphisms in candidate proteins. As part of this study, we screened the gene for the enzyme thymidylate synthase (TS). TS is important physiologically because it is essential for the synthesis of deoxythymidylate, a nucleotide required for DNA synthesis and repair. TS is also a major target for cancer chemotherapeutic drugs, especially the widely used 5-fluorouracil. Using sequence alignment of ESTs, we identified a candidate 6-bp variation at bp 1494 in the 3'-untranslated region of the TS mRNA. This sequence variation occurred in 21 of 34 aligned ESTs at this location, including ESTs from various tissue sources. The presence of this polymorphism was confirmed in a Caucasian population (n = 95) by polymerase chain restriction amplification/RFLP analysis. The allele frequency of the 6-bp deletion was found to be 0.29 (wild-type +6 bp/+6 bp, 48%; +6 bp/-6 bp, 44%; -6 bp/-6 bp, 7%). Although the function of this polymorphism has not yet been investigated, the 3'-untranslated region of a gene can play a role in mRNA stability and translation. This study illustrates an approach to polymorphism discovery in candidate enzymes of physiological interest by searches of publicly available sequence data, a rapid and inexpensive method. The potential functional relevance of the common 6-bp deletion in the TS gene needs to be investigated, because this enzyme is plausibly of major importance not only in cancer treatment but also in cancer prevention.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
As part of the human genome project, terabytes of sequence information are stored in public databases. ESTs3 comprise much of the available data; they are partial cDNA sequences that have been generated from many different tissues. ESTs reflect some or all of the transcribed sequence of a gene, which includes the coding sequence as well as 5'- and 3'-UTRs. Currently, the EST database for humans contains more than one million entries and is publicly available.4 As demonstrated by others (1, 2, 3, 4) , this resource is a rich source for identifying genetic variations. Whereas most of these researchers used a broad search pattern, it is possible to direct screening of ESTs to specific proteins of physiological interest. On the basis of findings linking folate availability to carcinogenesis, our interest focused on enzymes in folate metabolism.

TS (EC 2.1.1.45) is an enzyme that catalyzes the conversion of deoxyuridylate to deoxythymidylate by simultaneous conversion of 5,10-methylenetetrahydrofolate to dihydrofolate (Fig. 1)Citation . Thus, TS is essential for the provision of a nucleotide required for both DNA synthesis and repair. TS is an essential enzyme in proliferating cells and is also an important target for a variety of chemotherapeutic drugs, including 5-FU. Thus, TS plays a major role in cancer therapy and possibly in cancer prevention.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1. Role of thymidylate synthase; in folate metabolism. TS = thymidylate synthase; dUMP, deoxyuridine monophosphate; dTMP, deoxythymidine monophosphate; THF, tetrahydrofolate; DHF, dihydrofolate; MTHFR, 5,10-methylenetetrahydrofolate reductase; MS, methionine synthase; SAM, S-adenosylmethionine; SAH, S-adenosylhomocysteine.

 
Genetic polymorphisms in the TS gene may result in altered enzyme function. This could affect cancer susceptibility as well as treatment efficacy and the toxicity of antifolate cancer therapeutics. A common polymorphism in another enzyme in folate metabolism, 5,10-methylenetetrahydrofolate reductase has been found to be associated with risk of both cancer and preneoplastic lesions; in several studies, this association was modified by folate status, resulting in an increased risk among those with low folate intake (5, 6, 7, 8) .

To date, only one functional polymorphism in the TS gene has been reported, and its prevalence in Caucasians is unknown (9) . We undertook a search for new genetic polymorphisms in TS by screening public databases of ESTs and identified a common 6-bp deletion in the 3'-UTR of the TS gene.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
EST Database Search.
The EST database is publicly available on the NCBI web site.4 A search for matching ESTs was carried out with BLAST, which is also available at the NCBI web site (10) . The reference sequence used was the TS cDNA sequence (GenBank accession no. X02308). The "flat master-slave with identities" alignment view option in BLAST was used to present the EST sequences in a multiple-sequence alignment with the reference sequence. This option provides a simultaneous display of the aligned sequences and the reference sequence, which can be scanned for common sequence variations.

Verification of a TS Candidate Polymorphism in a Caucasian Population.
The presence of a TS candidate polymorphism was verified in a Caucasian population (n = 95). These individuals were initially recruited for a case-control study in Minnesota in 1991–1994 that was approved by the University of Minnesota Institutional Review Board. DNA was obtained from buffy coat as part of the study protocol, part of which was specifically focused on the role of genetic variability in the etiology of colorectal neoplasia.

Genomic DNA was extracted from peripheral WBCs using the Puregene kit (Gentra Systems, Minneapolis, MN). A RFLP spanning the 6-bp insertion or deletion was used to verify the existence of the TS 3'-UTR polymorphism at bp 1494. The presence of the 6 bp creates a DraI restriction site. The fragment containing the polymorphism was amplified by PCR using primers 5'CAAATCTGAGGGAGCTGAGT3' and 5'CAGATAAGTGGCAGTACAGA3' in a reaction containing 10 mM Tris (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 150 µM deoxynucleotide triphosphates, 300 nM each primer, 100 ng of genomic DNA, and 1unit of AmpliTaq DNA polymerase (PE Biosystems, Foster City, CA). The cycling conditions were: 1 cycle of 94°C for 5 min; 30 cycles of 94°C for 30 s, 58°C for 45 s, and 72°C for 45 s; and 1 cycle of 72°C for 5 min. The amplified fragments were digested with DraI and the products separated on a 3% NuSieve agarose gel. The expected fragment sizes are 70 bp and 88 bp for the wild-type allele and 152 bp for the mutant allele. {chi}2 analysis was performed to test for agreement with Hardy-Weinberg equilibrium.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
EST Database Searches.
On the basis of the complete coding sequence of TS (GenBank accession number X02308), we identified 99 matches of human ESTs (Fig. 2)Citation .



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2. Distribution of 99 aligned ESTs of TS (GenBank accession no. X02308).

 
We reviewed the identified ESTs and their alignment with the coding sequence. As part of our quality control measures, we restricted the retrieved ESTs to the 59 matches where the probability that the match between the observed sequence (EST) and the reference sequence occurred by chance was less than 10-90. On the basis of our review of the specific ESTs, those were all of the relevant ESTs that were successfully aligned over a long stretch of sequence. This quality control measure also excludes sequences with a large number of sequencing errors. As ESTs are usually produced via single-pass automated sequencing, errors are common. The alignment provided several regions of interest, including what appeared as a common 6-bp insertion (compared with the reference coding sequence) in the 3'-UTR at bp 1494 (Fig. 3)Citation . This sequence variation occurred in 21 of 34 aligned ESTs in this region. Evaluation of the tissue sources of the aligned ESTs showed that the variant ESTs were derived from several different tissue sources and laboratories.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 3. ESTs (n = 34) aligned with reference coding sequence for TS demonstrating a 6-base-pair variation (TTAAAG) at base pair 1494 ("." corresponds to a nucleotide identical to the reference sequence).

 
Verification of the New TS Candidate Polymorphism in a Caucasian Population.
We used a RFLP spanning the 6-bp variation to verify the existence of the TS 3'-UTR polymorphism at bp 1494 among 95 Caucasians. Results of the digestion are shown in Fig. 4Citation . Individuals homozygous for the presence of the 6 bp (+6/+6) are characterized by two fragments of 88 and 70 bp, respectively, whereas individuals homozygous for the absence of the 6bp (-6/-6) are characterized by a single fragment of 152 bp in length. Heterozygotes show all three bands. The158-bp band in the heterozygous samples is caused by an undigested wild-type fragment.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 4. RFLP analysis of the 152/158-bp PCR product for the 6-bp deletion polymorphism at nucleotide 1494. Digestion of the product with DraI indicates presence or absence of the 6-bp deletion. Sizes in bp for the allele fragments are indicated on the left-hand side, sizes of the kb-ladder are indicated on the right-hand side.

 
Genotype frequencies among 95 Caucasian individuals are shown in Table 1Citation . On the basis of these studies, we established an allele frequency of 0.71 for the +6-bp allele and 0.29 for the -6-bp allele. Given the prevalence of these alleles, we regard the 6-bp deletion as the variant. Seven percent of our study population were homozygous variant for the 6-bp deletion, and the genotype frequencies were in Hardy-Weinberg equilibrium.


View this table:
[in this window]
[in a new window]
 
Table 1 TS 3'-UTR genotype prevalence among 95 Caucasian individuals

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study demonstrates that the human EST database can be a valuable tool for identifying new candidate polymorphism in proteins of specific interest. This approach is cost-effective and requires little time; it has already been used by other investigators, largely in broad-based screening efforts (1, 2, 3) . For our directed approach, the search for polymorphisms using EST databases entailed the following steps: (a) identification of a protein/gene of interest; (b) identification of an appropriate reference sequence and its accession number [e.g., via the Online Mendelian Inheritance in Man (OMIM) website5 ]; (c) BLAST search for matching human ESTs at NCBI, and paired alignment with the reference sequence; (d) visual (or automated) search for locations with at least two alternative sequences (nucleotide substitutions, insertions/deletions); and (e) evaluation of the location of the candidate polymorphism (5'-UTR; coding region; or 3'-UTR) and potential effect on amino acid sequence.

ESTs are submitted to the databases as part of the overall genomic analysis and are subject to fewer checks than accepted genomic or coding sequences. Therefore, sequencing errors can be quite common; this requires several quality control measures to increase the likelihood that an observed sequence variation constitutes a true polymorphism rather than a sequencing error. The measures used in this study include (a) the exclusion of sequences with a multitude of differences from the reference sequences (these may be error prone, but may also be expressed from a second related gene with significant sequence similarity); (b) exclusion of regions of an EST with multiple matching errors; (c) restriction to sequences with a very low likelihood of a random match, based on a probability calculated by BLAST; and (d) consideration only of candidate polymorphisms that occur in at least two ESTs from independent tissue sources.

The approach of screening EST databases for polymorphisms is naturally limited by the number of available ESTs and thus is more applicable to widely expressed genes and for common polymorphisms. Similarly, only the transcribed region can be investigated, but this is usually the genomic region of greater interest. A limitation of this approach is that ESTs are usually cloned from the 3' end [beginning at the poly(A) sequence] and reverse transcription usually does not yield full-length clones. Thus, ESTs containing 3' sequences are overrepresented. The very 3' end of an mRNA is noncoding but can contain sequences determining mRNA stability. Although the significance of mutations in the 3'-UTR is not as obvious as mutations resulting in amino acid changes, mRNA turnover can be affected. Differences in mRNA turnover alter steady-state levels of a given mRNA, which, in turn, determines protein expression levels.

TS is essential in the regulation of the balanced supply of the four nucleotides required for the normal replication of DNA and plays a central role in folate metabolism. The importance of an adequate folate supply for cancer prevention has been demonstrated in several recent studies, showing an elevated risk of colon cancer and colorectal adenoma (11, 12, 13, 14, 15, 16, 17) , pancreatic cancer (18) , and possibly breast cancer (19, 20, 21) associated with low folate status, particularly if combined with high alcohol consumption. The observed association with cancer risk may be attributable to a pathway associated with nucleotide synthesis; folate deficiency can result in deoxynucleotide triphosphate pool disturbances in rats (22 , 23) , in incorporation of uracil instead of thymidine into DNA, and subsequently in chromosome breaks attributable to transient nicks (24 , 25) . It is very likely that these effects are mediated by decreased TS activity attributable to a lack of substrate.

Inhibition of TS has antiproliferative effects, a mechanism used by several "antifolate" chemotherapeutic drugs, particularly 5-FU and raltitrexed. It has been shown that resistance to 5-FU, as well as patient survival, is often associated with increased TS expression (26, 27, 28, 29, 30) . Thus, functional genetic polymorphisms in TS could be relevant for cancer treatment.

In summary, we report here on a new, common polymorphism in the TS gene identified using a public EST database. The presence of this polymorphism has been confirmed in a Caucasian population. Potential effects of the TS 6-bp deletion at bp 1494 on function have not yet been investigated. Although the 3'-UTR of a gene is not translated into protein, it often plays an important role for maintaining mRNA stability. If changes in the secondary mRNA structure (e.g., folding) take place, translation can also be affected. Others have shown that a common point-mutation polymorphism in the 3'-UTR (polyadenylation signal) of the N-Acetyltransferase 1 (NAT1) gene is associated with altered enzyme activity in bladder and colon tissues (31) . It is possible that a deletion of 6 bp in the 3'-UTR affects mRNA stability or secondary mRNA structure and could thus ultimately affect protein levels of TS or response to up-regulation of this enzyme. If this polymorphism is associated with alterations in enzyme activity, it could be of major importance for cancer chemotherapy and possibly for cancer prevention.


    Acknowledgments
 
We would like to thank Angela C. Bush and Sushma S. Thomas for technical assistance with the thymidylate synthase genotyping and Clayton Hibbert and Mari Nakayoshi for assistance with the graphics.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the National Institute of Environmental Health Sciences Center P30, ES-07033. Back

2 To whom requests for reprints should be addressed, to Cancer Prevention Research Program, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N, MP-900, Seattle, WA 98109-1024. Phone: (206) 667-7617; Fax: (206) 667-7850; Email: nulrich{at}fhcrc.org Back

3 The abbreviations used are: EST, expressed sequence tag; UTR, untranslated region; TS, thymidylate synthase; 5-FU, 5-fluorouracil; NCBI, National Center for Biotechnology Information; BLAST, Basic Local Alignment Search Tool. Back

4 Internet address: http://www.ncbi.nlm.nih.gov/dbEST/. Back

5 Internet address: http://www.hgmp.mrc.ac.uk/omim/. Back

Received 5/ 3/00; revised 9/28/00; accepted 10/ 5/00.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Garg K., Green P., Nickerson D. Identification of candidate coding region single nucleotide polymorphisms in 165 human genes using assembled expressed sequence tags. Genome Res., 9: 1087-1092, 1999.[Abstract/Free Full Text]
  2. Buetow K. H., Edmonson M. N., Cassidy A. B. Reliable identification of large numbers of candidate SNPs from public EST data. Nat. Genet., 21: 323-325, 1999.[Medline]
  3. Picoult-Newberg L., Ideker T. E., Pohl M. G., Taylor S. L., Donaldson M. A., Nickerson D. A., Boyce-Jacino M. Mining SNPs from EST databases. Genome Res., 9: 167-174, 1999.[Abstract/Free Full Text]
  4. Blackburn A., Tzeng H., Anders M., Board P. Discovery of a functional polymorphism in human glutathione transferase zeta by expressed sequence tag database analysis. Pharmacogenetics, 10: 49-57, 2000.[Medline]
  5. Chen J., Giovannucci E., Kelsey K., Rimm E. B., Stampfer M. J., Colditz G. A., Spiegelman D., Willett W. C., Hunter D. J. A methylenetetrahydrofolate reductase polymorphism and the risk of colorectal cancer. Cancer Res., 56: 4862-4864, 1996.[Abstract/Free Full Text]
  6. Ma J., Stampfer M. J., Giovannucci E., Artigas C., Hunter D. J., Fuchs C., Willett W. C., Selhub J., Hennekens C. H., Rozen R. Methylenetetrahydrofolate reductase polymorphism, dietary interactions, and risk of colorectal cancer. Cancer Res., 57: 1098-1102, 1997.[Abstract/Free Full Text]
  7. Ulrich C., Kampman E., Bigler J., Schwartz S., Chen C., Bostick R., Fosdick L., Beresford S., Yasui Y., Potter J. Colorectal adenomas and the C677T MTHFR polymorphism: evidence for gene-environment interaction?. Cancer Epidemiol. Biomark. Prev., 8: 659-668, 1999.[Abstract/Free Full Text]
  8. Slattery M. L., Potter J. D., Samowitz W., Schaffer D., Leppert M. Methylenetetrahydrofolate reductase, diet, and risk of colon cancer. Cancer Epidemiol. Biomark. Prev., 8: 513-518, 1999.[Abstract/Free Full Text]
  9. Horie N., Aiba H., Oguro K., Hojo H., Takeishi K. Functional analysis and DNA polymorphism of the tandemly repeated sequences in the 5'-terminal regulatory region of the human gene for thymidylate synthase. Cell Struct. Funct., 20: 191-197, 1995.[Medline]
  10. Altschul S. F., Madden T. L., Schaffer A. A., Zhang J., Zhang Z., Miller W., Lipman D. J. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res., 25: 3389-3402, 1997.[Abstract/Free Full Text]
  11. Benito E., Obrador A., Stiggelbout A., Bosch F. X., Mulet M., Munoz N., Kaldor J. A population-based case-control study of colorectal cancer in Majorca. I. Dietary factors. Int. J. Cancer, 45: 69-76, 1990.[Medline]
  12. Paspatis G. A., Kalafatis E., Oros L., Xourgias V., Koutsioumpa P., Karamanolis D. G. Folate status and adenomatous colonic polyps. A colonoscopically controlled study. Dis. Colon Rectum, 38: 64-67, 1995.[Medline]
  13. Giovannucci E., Stampfer M. J., Colditz G. A., Rimm E. B., Trichopoulos D., Rosner B. A., Speizer F. E., Willett W. C. Folate, methionine, and alcohol intake and risk of colorectal adenoma. J. Natl. Cancer Inst., 85: 875-884, 1993.[Abstract/Free Full Text]
  14. Giovannucci E., Rimm E. B., Ascherio A., Stampfer M. J., Colditz G. A., Willett W. C. Alcohol, low-methionine–low-folate diets, and risk of colon cancer in men. J. Natl. Cancer Inst., 87: 265-273, 1995.[Abstract/Free Full Text]
  15. Glynn S. A., Albanes D., Pietinen P., Brown C. C., Rautalahti M., Tangrea J. A., Gunter E. W., Barrett M. J., Virtamo J., Taylor P. R. Colorectal cancer and folate status: a nested case-control study among male smokers. Cancer Epidemiol. Biomark. Prev., 5: 487-494, 1996.[Abstract]
  16. Kato I., Dnistrian A. M., Schwartz M., Toniolo P., Koenig K., Shore R. E., Akhmedkhanov A., Zeleniuch-Jacquotte A., Riboli E. Serum folate, homocysteine and colorectal cancer risk in women: a nested case-control study. Br. J. Cancer, 79: 1917-1922, 1999.[Medline]
  17. Baron J. A., Sandler R. S., Haile R. W., Mandel J. S., Mott L. A., Greenberg E. R. Folate intake, alcohol consumption, cigarette smoking, and risk of colorectal adenomas. J. Natl. Cancer Inst., 90: 57-62, 1998.[Abstract/Free Full Text]
  18. Stolzenberg-Solomon R. Z., Albanes D., Nieto F. J., Hartman T. J., Tangrea J. A., Rautalahti M., Sehlub J., Virtamo J., Taylor P. R. Pancreatic cancer risk and nutrition-related methyl-group availability indicators in male smokers. J. Natl. Cancer Inst., 91: 535-541, 1999.[Abstract/Free Full Text]
  19. Zhang S., Hunter D. J., Hankinson S. E., Giovannucci E. L., Rosner B. A., Colditz G. A., Speizer F. E., Willett W. C. A prospective study of folate intake and the risk of breast cancer. J. Am. Med. Assoc., 281: 1632-1637, 1999.[Abstract/Free Full Text]
  20. Rohan T. E., Jain M. G., Howe G. R., Miller A. B. Dietary folate consumption and breast cancer risk. J. Natl. Cancer Inst., 92: 266-269, 2000.[Free Full Text]
  21. Ronco A., De Stefani E., Boffetta P., Deneo-Pellegrini H., Mendilaharsu M., Leborgne F. Vegetables, fruits, and related nutrients and risk of breast cancer: a case-control study in Uruguay. Nutr Cancer, 35: 111-119, 1999.[Medline]
  22. James S. J., Yin L. Diet-induced, DNA damage and altered nucleotide metabolism in lymphocytes from methyl-donor-deficient rats. Carcinogenesis (Lond.), 10: 1209-1214, 1989.[Abstract/Free Full Text]
  23. James S. J., Cross D. R., Miller B. J. Alterations in nucleotide pools in rats fed diets deficient in choline, methionine and/or folic acid. Carcinogenesis (Lond.), 13: 2471-2474, 1992.[Abstract/Free Full Text]
  24. Blount B. C., Mack M. M., Wehr C. M., MacGregor J. T., Hiatt R. A., Wang G., Wickramasinghe S. N., Everson R. B., Ames B. N. Folate deficiency causes uracil misincorporation into human DNA and chromosome breakage: implications for cancer and neuronal damage. Proc. Natl. Acad. Sci. USA, 94: 3290-3295, 1997.[Abstract/Free Full Text]
  25. Fenech M., Aitken C., Rinaldi J. Folate, vitamin B12, homocysteine status and DNA damage in young Australian adults. Carcinogenesis (Lond.), 19: 1163-1171, 1998.[Abstract/Free Full Text]
  26. van Triest B., Pinedo H. M., van Hensbergen Y., Smid K., Telleman F., Schoenmakers P. S., van der Wilt C. L., van Laar J. A., Noordhuis P., Jansen G., Peters G. J. Thymidylate synthase level as the main predictive parameter for sensitivity to 5-fluorouracil, but not for folate-based thymidylate synthase inhibitors, in 13 nonselected colon cancer cell lines. Clin. Cancer Res., 5: 643-654, 1999.[Abstract/Free Full Text]
  27. Bathe O. F., Franceschi D., Livingstone A. S., Moffat F. L., Tian E., Ardalan B. Increased thymidylate synthase gene expression in liver metastases from colorectal carcinoma: implications for chemotherapeutic options and survival. Cancer J. Sci. Am., 5: 34-40, 1999.[Medline]
  28. Kirihara Y., Yamamoto W., Toge T., Nishiyama M. Dihydropyrimidine dehydrogenase, multidrug resistance-associated protein, and thymidylate synthase gene expression levels can predict 5-fluorouracil resistance in human gastrointestinal cancer cells. Int. J. Oncol., 14: 551-556, 1999.[Medline]
  29. Lenz H. J., Danenberg K. D., Leichman C. G., Florentine B., Johnston P. G., Groshen S., Zhou L., Xiong Y. P., Danenberg P. V., Leichman L. P. p53 and thymidylate synthase expression in untreated stage II colon cancer: associations with recurrence, survival, and site. Clin. Cancer Res., 4: 1227-1234, 1998.[Abstract]
  30. Vlaykova T., Jekunen A. P., Kesomaa M., Kairemo K. J., Pyrhonen S., Wasenius V. M. Increased thymidylate synthase gene expression in metastatic melanoma. Oncology, 54: 146-152, 1997.[Medline]
  31. Bell D. A., Badawi A. F., Lang N. P., Ilett K. F., Kadlubar F. F., Hirvonen A. Polymorphism in the N-acetyltransferase 1 (NAT1) polyadenylation signal: association of NAT1*10 allele with higher N-acetylation activity in bladder and colon tissue. Cancer Res., 55: 5226-5229, 1995.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. M. Ulrich, M. Neuhouser, A. Y. Liu, A. Boynton, J. F. Gregory III, B. Shane, S. J. James, M. C. Reed, and H. F. Nijhout
Mathematical Modeling of Folate Metabolism: Predicted Effects of Genetic Polymorphisms on Mechanisms and Biomarkers Relevant to Carcinogenesis
Cancer Epidemiol. Biomarkers Prev., July 1, 2008; 17(7): 1822 - 1831.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
B. R. Tan, W. S. Brenner, J. Picus, S. Marsh, F. Gao, C. Fournier, P. M. Fracasso, J. James, J. L. Yen-Revollo, and H. L. Mcleod
Phase I study of biweekly oxaliplatin, gemcitabine and capecitabine in patients with advanced upper gastrointestinal malignancies
Ann. Onc., June 4, 2008; (2008) mdn375v1.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. E. Kelemen, T. A. Sellers, J. M. Schildkraut, J. M. Cunningham, R. A. Vierkant, V. S. Pankratz, Z. S. Fredericksen, M. K. Gadre, D. N. Rider, M. Liebow, et al.
Genetic Variation in the One-Carbon Transfer Pathway and Ovarian Cancer Risk
Cancer Res., April 1, 2008; 68(7): 2498 - 2506.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Sharma, J. M. Hoskins, L. P. Rivory, M. Zucknick, R. London, C. Liddle, and S. J. Clarke
Thymidylate Synthase and Methylenetetrahydrofolate Reductase Gene Polymorphisms and Toxicity to Capecitabine in Advanced Colorectal Cancer Patients
Clin. Cancer Res., February 1, 2008; 14(3): 817 - 825.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
K. Shan, M. Xiao-Wei, W. Na, Z. Xiu-Feng, W. Deng-Gui, G. Wei, Z. Zheng-Mao, and L. Yan
Association of three single nucleotide polymorphisms of the E-cadherin gene with endometriosis in a Chinese population
Reproduction, August 1, 2007; 134(2): 373 - 378.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. Ruzzo, F. Graziano, F. Loupakis, E. Rulli, E. Canestrari, D. Santini, V. Catalano, R. Ficarelli, P. Maltese, R. Bisonni, et al.
Pharmacogenetic Profiling in Patients With Advanced Colorectal Cancer Treated With First-Line FOLFOX-4 Chemotherapy
J. Clin. Oncol., April 1, 2007; 25(10): 1247 - 1254.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Largillier, M.-C. Etienne-Grimaldi, J.-L. Formento, J. Ciccolini, J.-F. Nebbia, A. Ginot, M. Francoual, N. Renee, J.-M. Ferrero, C. Foa, et al.
Pharmacogenetics of capecitabine in advanced breast cancer patients.
Clin. Cancer Res., September 15, 2006; 12(18): 5496 - 5502.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Pullmann Jr., K. Abdelmohsen, A. Lal, J. L. Martindale, R. D. Ladner, and M. Gorospe
Differential Stability of Thymidylate Synthase 3'-Untranslated Region Polymorphic Variants Regulated by AUF1
J. Biol. Chem., August 18, 2006; 281(33): 23456 - 23463.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
A. Ruzzo, F. Graziano, K. Kawakami, G. Watanabe, D. Santini, V. Catalano, R. Bisonni, E. Canestrari, R. Ficarelli, E. T. Menichetti, et al.
Pharmacogenetic Profiling and Clinical Outcome of Patients With Advanced Gastric Cancer Treated With Palliative Chemotherapy
J. Clin. Oncol., April 20, 2006; 24(12): 1883 - 1891.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
E. Dotor, M. Cuatrecases, M. Martinez-Iniesta, M. Navarro, F. Vilardell, E. Guino, L. Pareja, A. Figueras, D. G. Mollevi, T. Serrano, et al.
Tumor Thymidylate Synthase 1494del6 Genotype As a Prognostic Factor in Colorectal Cancer Patients Receiving Fluorouracil-Based Adjuvant Treatment
J. Clin. Oncol., April 1, 2006; 24(10): 1603 - 1611.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
T. J. Lightfoot, C. F. Skibola, E. V. Willett, D. R. Skibola, J. M. Allan, F. Coppede, P. J. Adamson, G. J. Morgan, E. Roman, and M. T. Smith
Risk of Non-Hodgkin Lymphoma Associated with Polymorphisms in Folate-Metabolizing Genes
Cancer Epidemiol. Biomarkers Prev., December 1, 2005; 14(12): 2999 - 3003.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. Justenhoven, U. Hamann, C. B. Pierl, S. Rabstein, B. Pesch, V. Harth, C. Baisch, C. Vollmert, T. Illig, T. Bruning, et al.
One-Carbon Metabolism and Breast Cancer Risk: No Association of MTHFR, MTR, and TYMS Polymorphisms in the GENICA Study from Germany
Cancer Epidemiol. Biomarkers Prev., December 1, 2005; 14(12): 3015 - 3018.
[Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. M. Ulrich, K. Curtin, J. D. Potter, J. Bigler, B. Caan, and M. L. Slattery
Polymorphisms in the Reduced Folate Carrier, Thymidylate Synthase, or Methionine Synthase and Risk of Colon Cancer
Cancer Epidemiol. Biomarkers Prev., November 1, 2005; 14(11): 2509 - 2516.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
Z. Zhang, Y. Xu, J. Zhou, X. Wang, L. Wang, X. Hu, J. Guo, Q. Wei, and H. Shen
Polymorphisms of thymidylate synthase in the 5'- and 3'-untranslated regions associated with risk of gastric cancer in South China: a case-control analysis
Carcinogenesis, October 1, 2005; 26(10): 1764 - 1769.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Kawakami, F. Graziano, G. Watanabe, A. Ruzzo, D. Santini, V. Catalano, R. Bisonni, F. Arduini, I. Bearzi, S. Cascinu, et al.
Prognostic Role of Thymidylate Synthase Polymorphisms in Gastric Cancer Patients Treated with Surgery and Adjuvant Chemotherapy
Clin. Cancer Res., May 15, 2005; 11(10): 3778 - 3783.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
Q. Shi, Z. Zhang, A. S. Neumann, G. Li, M. R. Spitz, and Q. Wei
Case-control analysis of thymidylate synthase polymorphisms and risk of lung cancer
Carcinogenesis, March 1, 2005; 26(3): 649 - 656.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. E. Carlini, N. J. Meropol, J. Bever, M. L. Andria, T. Hill, P. Gold, A. Rogatko, H. Wang, and R. L. Blanchard
UGT1A7 and UGT1A9 Polymorphisms Predict Response and Toxicity in Colorectal Cancer Patients Treated with Capecitabine/Irinotecan
Clin. Cancer Res., February 1, 2005; 11(3): 1226 - 1236.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
J. Zhang, Y. Cui, G. Kuang, Y. Li, N. Wang, R. Wang, W. Guo, D. Wen, L. Wei, F. Yu, et al.
Association of the thymidylate synthase polymorphisms with esophageal squamous cell carcinoma and gastric cardiac adenocarcinoma
Carcinogenesis, December 1, 2004; 25(12): 2479 - 2485.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Z. Zhang, Q. Shi, E. M. Sturgis, M. R. Spitz, W. K. Hong, and Q. Wei
Thymidylate Synthase 5'- and 3'-Untranslated Region Polymorphisms Associated with Risk and Progression of Squamous Cell Carcinoma of the Head and Neck
Clin. Cancer Res., December 1, 2004; 10(23): 7903 - 7910.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Lecomte, J.-M. Ferraz, F. Zinzindohoue, M.-A. Loriot, D.-A. Tregouet, B. Landi, A. Berger, P.-H. Cugnenc, R. Jian, P. Beaune, et al.
Thymidylate Synthase Gene Polymorphism Predicts Toxicity in Colorectal Cancer Patients Receiving 5-Fluorouracil-based Chemotherapy
Clin. Cancer Res., September 1, 2004; 10(17): 5880 - 5888.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
L. Sharp and J. Little
Polymorphisms in Genes Involved in Folate Metabolism and Colorectal Neoplasia: A HuGE Review
Am. J. Epidemiol., March 1, 2004; 159(5): 423 - 443.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. Chen, D. J. Hunter, M. J. Stampfer, C. Kyte, W. Chan, J. G. Wetmur, R. Mosig, J. Selhub, and J. Ma
Polymorphism in the Thymidylate Synthase Promoter Enhancer Region Modifies the Risk and Survival of Colorectal Cancer
Cancer Epidemiol. Biomarkers Prev., October 1, 2003; 12(10): 958 - 962.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
Z. Ye and J. M. Parry
The discovery and confirmation of single nucleotide polymorphisms in the human p53R2 gene by EST database analysis
Mutagenesis, September 1, 2002; 17(5): 361 - 364.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. M. Ulrich, J. Bigler, R. Bostick, L. Fosdick, and J. D. Potter
Thymidylate Synthase Promoter Polymorphism, Interaction with Folate Intake, and Risk of Colorectal Adenomas
Cancer Res., June 1, 2002; 62(12): 3361 - 3364.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ulrich, C. M.
Right arrow Articles by Potter, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ulrich, C. M.
Right arrow Articles by Potter, J. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online