| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Short Communications |
Epidemiology and Biostatistics Division, National Cancer Center Research Institute East, Chiba 277-8577, Japan [T. H., H. H., S. T.]; Institute for Science of Labor, Kawasaki 216-8501, Japan [T. H.]; and Tokyo Women’s Medical University, Tokyo 162-8666, Japan [Y. Y., J. K.]
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Some previous studies have suggested that mRNA expression of DNA repair genes in peripheral blood cells can provide information on susceptibility to cancer (9, 10, 11) , and we suspected that expression of hOGG1 mRNA might provide similar information. We also speculated that the mRNA level of peripheral blood cells might serve as a marker of exposure to reactive oxygen radicals or radical-generating factors because some reports have shown that repair activity might be induced by exposure to such factors (12, 13, 14) .
Quantitative determination of mRNA itself involves technical difficulties; however, a real-time PCR has recently been developed (15 , 16) and has yielded reproducible results. The objective of this preliminary study was to use the real-time PCR technique to evaluate the intra- and interindividual variation of hOGG1 mRNA levels in the peripheral blood cells of nonsmokers over a 1-year period and to assess whether its levels could serve as a biomarker in epidemiological studies.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Peripheral venous blood was collected into a Na2EDTA tube. The buffy coat was immediately fractionated from approximately 3 ml of blood by centrifugation. WBCs were obtained from the buffy coat by osmotic hemolysis using a 0.2% NaCl solution.
RNA Extraction.
Total RNA was isolated from WBCs by using a commercial RNA isolation
reagent according to the manufacturer’s instructions (Trizol reagent;
Life Technologies, Inc., Rockville, MD).
Reverse Transcription.
The prepared RNA was reverse transcribed to synthesize cDNA using avian
myeloblastosis virus reverse transcriptase XL according to the
manufacturer’s instructions (Takara Biochemicals, Osaka, Japan).
Real-Time PCR.
We used real-time TaqMan technology with an ABI Prism 7700 Sequence
Detector (PE Biosystems, Foster City, CA) to quantitatively
compare the mRNA levels. The principle of the technology has been
described elsewhere (15
, 16)
. The amount of template cDNA
was expressed by a threshold cycle (CT) that was
determined by the amplification curve (exponential phase) and a
threshold level of PCR product detection. One CT
was equal to a 2-fold difference in initial template.
hOGG1 mRNA levels were compared between subjects by a
comparative CT method with separate tubes, as
described elsewhere (User Bulletin 2; PE Biosystems). Briefly, the
individual level of initial target cDNA was expressed as the difference
in CT between the target and an endogenous
control (
CT). The relative amount of target in
a subject, normalized to an endogenous control, was finally given by
2-CT.
Specific primers and a specific TaqMan probe were designed between exon 2 and exon 3 according to a published sequence (GenBank AB000410): (a) forward primer, AATTCCAAGGTGTGCGACTG; (b) reverse primer, CGATGTTGTTGTTGGAGGAAC; and (c) probe, 5'-FAM-CGACAAGACCCCATCGAATGCCTTTTC-TAMRA-3'. The PCR reaction was carried out with TaqMan Universal PCR Master Mix according to the manufacturer’s instructions (PE Biosystems). We used the ß-actin gene as the endogenous control gene, and the PCR reaction for ß-actin was carried out according to the manufacturer’s instructions (predeveloped TaqMan assay reagent, human ß-actin; PE Biosystems).
All measurements were performed in duplicate experiments on one experiment day. The average difference in CT between duplicate analyses was 0.4 CT (about 1.3 times the difference in initial template).
Determination of Endogenous Control Genes.
Appropriate endogenous control genes were determined before measurement
of hOGG1 mRNA levels. Five healthy volunteers (age range,
26–40 years), including one smoker, voluntarily donated RNA samples,
and their samples were extracted by the method described above.
DNase-treated RNA was reverse transcribed to synthesize cDNA by using
SUPERSCRIPT II reverse transcriptase according to the manufacturer’s
instructions (Life Technologies, Inc.).
We examined interindividual differences in the candidate genes by using TaqMan human endogenous control plate (PE Biosystems). The candidate genes included 18S rRNA, acidic ribosomal protein, ß-actin, cyclophilin, GAPDH, phosphoglycerokinase, ß2-microglobulin, ß-glucuronidase, hypoxanthine ribosyl transferase, transcription factor IID TATA-binding protein, and transferrin receptor. With the exception of 18S rRNA, the primers and the probes of the candidate genes recognized only cDNA. The amount of cDNA sample for the PCR reaction was adjusted between subjects with a spectrophotometer. The PCR conditions were set according to manufacturer’s instructions. All measurements were performed in duplicate experiments.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
shows the results of quantitative comparison of 8 genes in the
11 candidates examined because mRNA levels of 3 genes,
hypoxanthine ribosyl transferase, transcription factor IID TATA-binding
protein, and transferrin receptor, were very low or undetectable in the
peripheral blood cells of most of these subjects. The 18S rRNA showed
the smallest interindividual differences among the genes studied. The
amounts of GAPDH, ß-actin, phosphoglycerokinase, and
ß-glucuronidase varied in a relatively small range (less than twice
the difference) compared with the others. The order of the
relative amounts of these genes in peripheral blood cells was as
follows: 18S rRNA > ß-actin > GAPDH >
phosphoglycerokinase > ß-glucuronidase (approximately
1000:1:0.1:0.025:0.002).
|
shows the intra- and interindividual variation of hOGG1 mRNA
levels in the peripheral blood cells of the subjects over a 1-year
period. The levels of hOGG1 mRNA ranged from 1.6 to 17.6
(hOGG1/ß-actin x 100). The
intraindividual variation ranged from 1.8 to 6.4
(hOGG1/ß-actin x 100). Although the
differences in the mRNA levels between the sampling dates were not
significant (P = 0.73, ANOVA), we observed a
significant difference in the mRNA levels between the subjects
(P < 0.01, ANOVA).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The analytical method used in this study, real-time PCR, provided a more accurate estimation than previous methods, including competitive reverse transcription-PCR using gel electrophoresis. We examined the exponential phase of the PCR reaction directly and compared the amount of initial template cDNA between subjects. Some housekeeping genes have been used for quantitative assessment of mRNA expression as endogenous controls to adjust the total amount of RNA between samples because such genes are thought to be expressed at the same level in all subjects. Expression of a target gene has been compared to that of an endogenous control gene by using photographs of a gel electrophoresis. However, it is well known that such methods yield large errors in determinations of the expression of the target genes. Moreover, some recent reports have suggested that the expression of such genes in some tissues may vary among study subjects (17) . The real-time quantitative PCR technique can provide a precise level of target gene expression; however, more appropriate internal controls need to be prepared.
First, we determined appropriate endogenous control genes in peripheral blood cells for quantitative analysis of mRNA. The 18S rRNA seemed to be the best endogenous control gene for quantitative gene expression studies using peripheral blood cells. However, we suspected that normalization using 18S rRNA might generate large errors when target genes are expressed at a relatively low levels because the 18S rRNA expression level is very high. The GAPDH, ß-actin, phosphoglycerokinase, and ß-glucuronidase genes seemed to be acceptable, although we should assume an error of approximately 2-fold. We used ß-actin as an endogenous control in this study.
Wei et al. (9, 10, 11) suggested that mRNA expression of DNA repair genes in peripheral blood cells could provide information on susceptibility to cancer. They observed that low expression of some mismatch repair genes (hMLH1 and hGTBP/hMSH6) was associated with an increased risk of head and neck cancer. The level of hOGG1 mRNA in peripheral blood cells may also provide information on susceptibility to cancer.
Whether the interindividual variation of a marker is greater than the intraindividual variation is indispensable information for a biomarker in epidemiological studies. Our observation showed that the interindividual variation of hOGG1 mRNA was larger than the intraindividual variation. The subjects seemed to fall into groups according to their individual levels of hOGG1 mRNA; however, the sample size in this preliminary study was limited, and thus we cannot conclude that the level is peculiar to each subject.
We can speculate that the interindividual variation of hOGG1 mRNA is genetically determined or epigenetically influenced by endogenous and/or environmental exposure. One possibility is that hOGG1 mRNA is induced by exposure to reactive oxygen radicals or radical-generating factors. Increased 8-oxoG repair activity has been demonstrated in smokers’ leukocytes (12) and in rats exposed to asbestos (13) . Moreover, Tsurudome et al. (14) demonstrated increased expression of hOGG1 in rats exposed to diesel exhaust particles. Some previous studies have suggested that quantitative assessment of mRNA expression in peripheral blood cells can provide information on exposure to environmental carcinogens. The target mRNA has been studied mainly with regard to metabolic enzymes and related cellular receptors (18, 19, 20) . In this study, we assessed hOGG1 mRNA levels only in nonsmokers. Additional studies are needed to determine the levels in subjects exposed to chemicals that generate reactive oxygen radicals.
We used peripheral WBCs because we have often stored WBCs in the form of buffy coat in epidemiological studies. Peripheral blood cells are a surrogate tissue for target organs, which are not easily obtained in epidemiological studies. Quantitative comparisons between hOGG1 mRNA levels in peripheral blood cells and in target organs are needed. However, the level in peripheral blood cells was adequate for comparisons between subjects, and it promises to provide information for epidemiological studies.
In conclusion, we use the real-time PCR technique to estimate intra- and interindividual variations of hOGG1 mRNA levels in peripheral blood cells over a 1-year period and found that the interindividual variation was larger than the intraindividual variation. Although more study is needed to validate these variations, and biological validation of this assay appears to be quite difficult at the present time, this preliminary study appears to provide initial information on the hOGG1 mRNA levels of peripheral blood cells as a biomarker for epidemiological studies on oxygen radicals, oxygen radical-related agents, and cancer.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
1 Supported in part by a Grant-in-Aid for the
Second Term Comprehensive 10-Year Strategy for Cancer Control and for
Cancer Research of the Ministry of Health and Welfare of Japan and a
Grant-in-Aid for Scientific Research from the Ministry of Education,
Science, Sports and Culture of Japan. T. H. is an Awardee of a
Research Fellowship from the Foundation for Promotion of Cancer
Research in Japan. 
2 To whom requests for reprints should be
addressed, at Epidemiology and Biostatistics Division, National Cancer
Center Research Institute East, 6-5-1 Kashiwanoha Kashiwa-shi, Chiba
277-8577, Japan. E-mail: stsugane{at}east.ncc.go.jp
3 The abbreviations used are: 8-oxoG,
8-oxoguanine; GAPDH, glyceraldehyde-3-phosphate dehydrogenase;
CT, threshold cycle.
Received 3/ 8/00; revised 8/16/00; accepted 8/18/00.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  T. Peng, L.-Q. Li, M.-H. Peng, Z.-M. Liu, T.-W. Liu, Y. Guo, K.-Y. Xiao, Z. Qin, X.-P. Ye, X.-S. Mo, et al. Evaluation of oxidative stress in a group of adolescents exposed to a high level of aflatoxin B1 a multi-center and multi-biomarker study Carcinogenesis, November 1, 2007; 28(11): 2347 - 2354. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Gu, M. R. Spitz, H. Zhao, J. Lin, H.B. Grossman, C. P. Dinney, and X. Wu Roles of tumor suppressor and telomere maintenance genes in cancer and aging--an epidemiological study Carcinogenesis, October 1, 2005; 26(10): 1741 - 1747. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
U. Vogel, P. Moller, L. Dragsted, S. Loft, A. Pedersen, and B. Sandstrom Inter-individual variation, seasonal variation and close correlation of OGG1 and ERCC1 mRNA levels in full blood from healthy volunteers Carcinogenesis, September 1, 2002; 23(9): 1505 - 1509. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
