
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of 1 Epidemiology and Biostatistics and 2 Neurological Surgery, University of California at San Francisco, San Francisco, California; 3 Department of Genetics and Complex Diseases, Harvard School of Public Health, Boston, Massachusetts; and 4 School of Public Health, University of California, Berkeley, California
Requests for reprints: Joseph L. Wiemels, University of California at San Francisco, 1 Irving Street, AC-34, San Francisco, CA 94143-0441. Phone: 415-514-0577; Fax: 415-502-7411. E-mail: joe.wiemels{at}ucsf.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
A notable theme of the studies mentioned above is the prominence of molecules that feature attributes of the T-cell helper-2 (Th2) branch of immunity, which is critical for clearance of certain human parasites and features strongly in conditions such as allergy and successful pregnancy. Successful immune reactions against cancer are thought to consist of largely a Th1 phenomenon, with the notable presence of cytotoxic T cells, natural killer cells, and activated macrophages (11). This branch of the immune system is effective at eradicating viral infections and other conditions that involve the creation of new intracellular antigens, such as cancer. Brain tumors (as well as normal brain tissue), however, strongly restrain the activity of Th1 immune reactions by means of suppressive cytokines; a physical architecture constrained to inhibit inflammation; a restricted repertoire of supportive immune cells, such as professional antigen-presenting cells; and low expression of stimulating cell surface major histocompatibility proteins (12-14). The available epidemiologic and clinical data noted above suggest that features associated with Th2-type immunity, such as allergies and high IgE levels, may help to improve anti-glioma immunity.
We recently showed that glioma cases had lower IgE levels, mirroring their lower reported allergy levels, than population-based frequency-matched controls (6). The decreased rate of allergies and lower IgE levels in glioma patients may have an underlying genetic basis. We now report on the role of common, well-characterized single nucleotide polymorphisms (SNP) and haplotypes in our study population in cytokine genes critical for allergy and essential for IgE production (IL4, IL4R, and IL13). These genes are among the most intensely studied SNPs for allergy and IgE production (15), providing an adequate initial survey into the genetics of immunoregulation and glioma. The receptors for IL13 are not appreciably polymorphic at the planning of this study and were not assessed here.
| Materials and Methods |
|---|
|
|
|---|
Genotyping
DNA was isolated from heparinized whole blood using Qiagen column purification. For subjects who provided buccal specimens, buccal swabs were inserted into a 1.5-mL tube with 300 to 600 µL of 50 mmol/L NaOH and vortexed. The brush was then removed from the tube, making sure all liquid was reserved. The tube was boiled in a water bath at 95°C for 5 min. The tube was centrifuged at 14,000 rpm for 1 min; the liquid was transferred into a new vial; and the solution was neutralized by adding a 1:10 volume (10% final concentration) of 1 mol/L Tris-EDTA (pH 8.0). DNA concentration was measured using Hoescht-33258 fluorimetry. Up to 10 µL was used in a 50 µL PCR reaction. All PCR reactions were at 94°C for 30 s at the various annealing temperatures specific for each gene sequence for another 30 s then at 72°C for a final 30 s. A portion was run on 3% to 4% agarose gel, and another portion of the product digested overnight or for 4 h at 37°C with a restriction enzyme that distinguished two alleles (variable depending on the sequence). A second electrophoresis run of the digested products indicated the genotype. Quality control measures include blinded analyses and the routine running of replicates of 10% of samples, DNA samples of known genotypes, and negative controls (no DNA). The dbSNP reference numbers are as follows: for IL4R, the numbers are rs1805010, rs1805011, rs1805012, rs1805015, rs1801275, rs1805016 for I75V, E400A, R431C, P503S, Q576R, and A752S, respectively. For IL4, the numbers are rs2243250 and rs2070874 for C-589T and C-34T, respectively. Finally, for IL13, the numbers are rs1800925 and rs20541 for C-1112T and Arg110Gln, respectively. Primers for genotyping IL4R and IL4 C-34T have been published (7). Additional primers include IL4 C-589T, ACCCAAACTAGGCCTCACCT and ACAGGTGGCATCTTGGAAAC; IL13 C-1112T, GGAATCCAGCATGCCTTGTGAGG and GTCGCCTTTTCCTGCTCTTCCCGC; and IL13 Arg110Gln, GAAACTTTTTCGCGAGGGGC and GAAACTTTTTCGCGAGGGGC.
Data Analysis
When considered singly, genotypes were considered both in a "dose-model" (heterozygotes having intermediate function between the two homozygote genotypes) and also in a "dominant model" (both heterozygote and homozygote variants are functionally equivalent). Because haplotypes are more rare, they were considered in the dominant model only. IgE levels were normalized by a transformation step: taking the least-squared means. Haplotypes at each locus were predicted using a Bayesian method implemented in PHASE 2.0 (16) and also using an expectation maximization algorithm in SAS/GENETICS (SAS Institute). Because of fairly strong linkage disequilibrium, results from both methods of haplotype prediction were virtually identical. Global likelihood ratio tests were done over all haplotypes and estimates of exact P values were computed using Monte Carlo methods with 10,000 permutations. Multiple logistic regression was used to model the log odds of disease as a function of the individual's haplotype probabilities, adjusting for age, gender, and ethnicity. In addition, the diplotype, or combination of two haplotypes, was predicted for each subject in the study, and each diplotype category was compared with regard to case-control status and IgE levels. IgE levels were adjusted for age, gender, smoking, ethnicity, and education level as described (6), as these factors were associated with IgE levels in many population studies. For case-control comparisons not involving IgE, adjustments for age and gender (only) were made. IgE levels were considered on a categorical scale for some analyses ("undetectable," "borderline," and "elevated"), as these categories have clinical significance (6); for other analyses, the least square means of IgE levels was used as a continuous variable as noted above. This transformed value of IgE approximates a Gaussian distribution.
| Results |
|---|
|
|
|---|
|
2 analysis. Individuals carrying the heterozygote or homozygote rare-variant of polymorphisms in IL4 and IL4R did not differ from those carrying the homozygote common-variant in IgE levels among the controls (Table 2
). IL13 polymorphisms on the other hand were significantly associated with IgE levels: the coding variant Arg110Gln (P < 0.001) and the promoter variant C-1112T (P = 0.04). Among the controls, there were no associations of any SNPs tested with numbers of allergies or IGE levels (data not shown). When control carriers of specific "risk" alleles (see below) were compared with the rest of controls, some trends emerged. Control carriers of IL4R 111110 haplotype were more likely to exhibit "elevated" serum IgE (4 of 15 controls or 27%) than controls that did not carry the haplotype (16 of 171 or 9.3%; P = 0.06, Fisher's exact test), but the least-squared mean of log(IgE) levels was not higher among carriers (P = 0.82). Control carriers of the 11 haplotype of IL13 had higher IgE levels than controls without this haplotype (least-squared mean IgE, 3.97 versus 3.25; P = 0.001). Finally, we did ANOVA tests to determine whether SNPs or diplotypes of IL4R, IL4, and IL13 were linked to having allergies or numbers of allergies and found no associations between these variables (data not shown).
|
|
|
|
| Discussion |
|---|
|
|
|---|
The associations detected here between IL13 C-1112T polymorphism and case-control status is consistent with the data of Schwartzbaum at al., who observed a case-control OR of 0.56 (95% CI, 0.33-0.96) for this SNP in the codominant model with 105 cases and 403 controls (8), but other polymorphisms were null in the current study when assessed singly. The 95% CIs in the two studies overlap for all SNPs studied in common, indicating that the data are in effect consistent (Table 3; ref. 8). These include two SNPs for IL4R (P503S and Q576R), which, when combined into haplotypes with four other SNPs 111110 (Table 5), yielded increased risk of brain cancer in case-control analysis, consistent in direction with Schwartzbaum, who observed a case control OR of 1.64 (95% CI, 1.05-2.55) for P503S and 1.61 (95% CI, 1.05-2.47) for Q576R (8). SNPs S503P and Q576R considered as haplotypes yielded a null result in our data (see Results), indicating the importance of including additional SNPs in the haplotype assessment and also suggesting that the S503P and Q576R are not the "causal" SNPs within the IL4R haplotype.
It should be emphasized that the IL4R 111110 haplotype was borderline associated with "risk" of brain tumor in this analysis (OR, 1.49; 95% CI, 0.99-2.25) in the opposite direction to our previous analysis in which this haplotype was highly associated with "protection" measured by longer survival of glioma patients in a case-only analysis (HR, 0.64; 95% CI, 0.47-0.87; P = 0.004). Our patient population for the survival study (7) essentially overlaps with this case-control study; therefore, there are not any obvious differences in population structure that could explain the discrepancy. Versions of this haplotype (using some but not all the same SNPs) were previously linked to increased atopic asthma, decreased type I diabetes, and increased sensitivity of the IL4R receptor or decreased IL4R activity (19-22). However, the minor alleles 503P and 576R have been associated with decreased IgE levels and atopy in other studies (23, 24). These minor alleles comprise the fourth and fifth position of the haplotype 111110. In our population, we were not able to detect an effect of 111110 or other IL4R haplotypes on allergies or IgE levels to help explain the difference in association between case-control and survival analysis. One possible explanation might be a survival bias: those individuals carrying 111110 may simply live long enough for ascertainment into our study (because it is associated with better survival), leading to a higher frequency of this haplotype among the cases, hence leading to the appearance of "risk" in the case-control analysis. From our series 2 patients (collected from 1997 to 1999), 73% of participating cases and 94% of controls provided blood for genotyping. (From series 1, only 39% of cases had blood drawn, but this was primarily due to our lack of resources for biological sample collection early in the study.) Most cases not providing blood (in series 2) were not alive at the time of interview/blood collection. Three months is the average time from diagnosis to ascertainment in our glioma study. We repeated the 111110 case-control analysis with patients and controls who had blood drawn within 3 months of diagnosis (patients) or identification (controls) and found that our OR did not change (OR, 1.50 for whole data set and OR, 1.52 for <3-month blood draw), arguing that the SNP may have an etiologic significance in addition to its previously shown survival effect. Survival bias (and etiologic bias in the case of survival studies!) should be carefully considered in future studies on this population.
In contrast to the IL4 haplotype, the IL13 haplotype was associated with protection in this analysis (Table 5). IL13 had no effect on survival in our case only analysis (OR, 0.93; 95% CI, 0.69-1.2), also in contrast to IL4R. Because the IL13 haplotype had no effect on survival of the genotyped cases, a potential survival bias is less likely in the case-control analysis. This result is consistent with an earlier report (25) and also consistent with the hypothesis that a polymorphism that is a risk factor for allergy should be protective for glioma. We believe that this result, not sullied by a potential survival bias as in the case of IL4R, is the most consistent result presented in this study, especially as IL13 polymorphisms are also associated with IgE levels in the expected direction (Table 2). This result is less likely to be due to chance or bias. Individuals who are genetically capable of producing higher levels or a more active IL13 cytokine may be protected from glioma. Such protection may become moot when full-blown cancer is present, in which IL4/IL13 pathways may be corrupted by the expression of aberrant levels of the IL13RA2 decoy receptor (26).
Reasons for lack of concordance of the OR estimates of the singleton genotypes between Schwartzbaum et al. (8) and our study may include several factors. First, environmental differences between Sweden and California may differentially affect allergy onset and the mechanism by which these immune factors affect glioma. Second, there may be genetic linkage differences between Swedes and U.S. residents, or unmeasured population substructure differences between cases and controls that is likely to be more complex in the San Francisco Bay Area than Sweden, thus biasing our results towards the null. Third, the smaller numbers in the Swedish study may be unstable, and the point estimates in the current study may be more accurate. When examined as a haplotype, our results are quite consistent with the Swedish study (8) indicating that there are likely to be genetic factor(s) in linkage disequilibrium with particular haplotypes in IL4R and IL13 that affects the risk of brain cancer and likely via an immune mechanism. A new study using a U.K./Danish cohort has also found haplotypes associated with glioma and will help further refine the associations observed here (25).
Because functional variants by themselves (except IL13 C-1112T) were not significantly related to case-control status, and specific haplotypes were, there remains the possibility that the associated haplotypes are in linkage disequilibrium with neighboring genes. Interestingly, the IL4R gene is located in chromosome 16 next to IL21R, a receptor critical to natural killer cell function, an important component of anti-immunity. IL4 and IL13 genes are both located next to each other within a cluster of cytokine-related genes in chromosome 5q31, further supporting this supposition. Future studies should assess genes neighboring to ones considered here.
This study has several strengths and limitations. Strengths include the large size (for a glioma study), relative ethnic homogeneity (for the bulk of the presented analyses), and limited number of measurements that are based on solid hypotheses. Limitations of the study include the role of chance that might lead to false-positive or false-negative findings, uncertain functional relevance of some of the SNPs measured, and limited statistical power particularly in relation to interaction tests.
The genetics of the immune system may be related to glioma under two scenarios. A genetic factor may underlie allergy onset, which may then affect the capacity of an individual's immune system to recognize and delete nascent brain tumors. Alternatively, a genetic factor may be related to allergy onset and glioma risk independently via other mechanisms on separate causal pathways. The SNPs that we assessed are good candidates for affecting IgE levels (in particular, IL13 SNPs) and allergies but only account for a small percentage of factors that affect IgE levels. For instance, IL13 haplotypes were predicted to account for only 0.59% of total IgE levels in a large study despite highly significant associations (reviewed in ref. 18). Other factors determining a point measurement of total IgE would include seasonality, proximity to allergen challenge, diet, and circadian rhythms. We put IgE and our allergy SNPs into the same model, including interaction terms, and found little or no effect on point estimates of these two factors and providing no evidence for interaction. It is highly unlikely given the evidence above that the SNPs measured here are the basis for the IgE-glioma or allergy-glioma connection previously discovered in this patient population (5, 6). Given that significant results were found for both IgE levels and SNPs, different, although not necessarily unrelated, pathways may be suggested by these two measurements.
In sum, this assessment of SNPs in immune-related genes in glioma etiology, when viewed as haplotypes, provides some confirmatory results to Schwartzbaum et al. (8) in a larger more diverse population and extends the analysis to IgE and allergies. This study invites a comprehensive assessment of polymorphisms in other related immune-related genes.
| Footnotes |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Note: J.L. Wiemels is a Scholar of the Leukemia and Lymphoma Society of America.
Received 1/12/07; revised 3/18/07; accepted 4/ 3/07.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. M. Ruder, T. Carreon, M. A. Butler, G. M. Calvert, K. E. Davis-King, M. A. Waters, P. A. Schulte, J. S. Mandel, R. F. Morton, D. J. Reding, et al. Exposure to Farm Crops, Livestock, and Farm Tasks and Risk of Glioma: The Upper Midwest Health Study Am. J. Epidemiol., June 15, 2009; 169(12): 1479 - 1491. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Rajaraman, A. V. Brenner, M. A. Butler, S. S. Wang, R. M. Pfeiffer, A. M. Ruder, M. S. Linet, M. Yeager, Z. Wang, N. Orr, et al. Common Variation in Genes Related to Innate Immunity and Risk of Adult Glioma Cancer Epidemiol. Biomarkers Prev., May 1, 2009; 18(5): 1651 - 1658. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Aldrich, S. Selvin, H. M. Hansen, L. F. Barcellos, M. R. Wrensch, J. D. Sison, C. P. Quesenberry, R. A. Kittles, G. Silva, P. A. Buffler, et al. Comparison of Statistical Methods for Estimating Genetic Admixture in a Lung Cancer Study of African Americans and Latinos Am. J. Epidemiol., November 1, 2008; 168(9): 1035 - 1046. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Scheurer, E. Amirian, Y. Cao, M. R. Gilbert, K. D. Aldape, D. G. Kornguth, R. El-Zein, and M. L. Bondy Polymorphisms in the Interleukin-4 Receptor Gene are Associated with Better Survival in Patients with Glioblastoma Clin. Cancer Res., October 15, 2008; 14(20): 6640 - 6646. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Chang, R.-F. Yeh, J. K. Wiencke, J. L. Wiemels, I. Smirnov, A. R. Pico, T. Tihan, J. Patoka, R. Miike, J. D. Sison, et al. Pathway Analysis of Single-Nucleotide Polymorphisms Potentially Associated with Glioblastoma Multiforme Susceptibility Using Random Forests Cancer Epidemiol. Biomarkers Prev., June 1, 2008; 17(6): 1368 - 1373. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.V. Brenner, M.A. Butler, S.S. Wang, A.M. Ruder, N. Rothman, P.A. Schulte, S.J. Chanock, H.A. Fine, M.S. Linet, and P.D. Inskip Single-nucleotide polymorphisms in selected cytokine genes and risk of adult glioma Carcinogenesis, December 1, 2007; 28(12): 2543 - 2547. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Schwartzbaum, A. Ahlbom, S. Lonn, B. Malmer, A. Wigertz, A. Auvinen, A. J. Brookes, H. Collatz Christensen, R. Henriksson, C. Johansen, et al. An International Case-Control Study of Interleukin-4R{alpha}, Interleukin-13, and Cyclooxygenase-2 Polymorphisms and Glioblastoma Risk Cancer Epidemiol. Biomarkers Prev., November 1, 2007; 16(11): 2448 - 2454. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |