CEBP Frontiers in Cancer Prevention Research - 2008 Cancer Health Disparities Conference 2009
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tao, M. H.
Right arrow Articles by Shu, X. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tao, M. H.
Right arrow Articles by Shu, X. O.
Cancer Epidemiology Biomarkers & Prevention Vol. 15, 2570-2573, December 2006
© 2006 American Association for Cancer Research

Null Results in Brief

Cytochrome P450 1B1 and Catechol-O-Methyltransferase Genetic Polymorphisms and Endometrial Cancer Risk in Chinese Women

Meng Hua Tao1,2, Qiuyin Cai1, Wang Hong Xu3, Nobuhiko Kataoka1, Wanqing Wen1, Wei Zheng1, Yong Bing Xiang3, Zuo-Feng Zhang2 and Xiao Ou Shu1

1 Department of Medicine, Vanderbilt Epidemiology Center, Vanderbilt University School of Medicine, Vanderbilt-Ingram Cancer Center, Nashville, Tennessee; 2 Department of Epidemiology, School of Public Health, University of California at Los Angeles, Los Angeles, California; and 3 Department of Epidemiology, Shanghai Cancer Institute, Shanghai, People's Republic of China

Requests for reprints: Xiao Ou Shu, Vanderbilt Epidemiology Center, Vanderbilt University, 6009 Medical Center East, 1215 21st Avenue South, Nashville, TN 37232-8300. Phone: 615-936-0713; Fax: 615-936-1269. E-mail: xiao-ou.shu{at}vanderbilt.edu


   Introduction
Top
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Metabolic conversion of estrogen to hydroxyl estrogens has been postulated to be involved in the carcinogenesis of the endometrium. Highly expressed in endometrial tissue, cytochrome P450 1B1 (CYP1B1) catalyzes the hydroxylation of 17ß-estradiol (E2) to catechol estrogens 4-hydroxyestradiol (4-OH-E2) and 2-hydroxyestradiol (2-OH-E2; ref. 1). Administration of 4-OH-E2 could induce DNA damage and endometrial adenocarcinoma in CD-1 mice (2). Five common polymorphisms with amino acid substitutions of the CYP1B1 gene have been described; compared with the wild type, CYP1B1 variants in codons 48 (Arg -> Gly, rs10012), 119 (Ala -> Ser, rs1056827), 432 (Leu -> Val, rs1056836), and 453 (Asn -> Ser, rs1800440) display 2.4- to 3.4-fold higher catalytic efficiency (1, 3-5). Catechol-O-methyltransferase (COMT) catalyzes O-methylation of catechol estrogens (2-OH-E2 and 4-OH-E2) to methoxy-catechol estrogens (2-MeO-E2 and 4-MeO-E2), which have no estrogenic activity. If the methylation step is incomplete, some of these catechol estrogens could induce DNA single-strand breaks, or initiate the carcinogenic process through reacting with DNA and forming depurinated adducts (6). A functional polymorphism in the COMT gene, a G-to-A transition at codon 108/158 in exon 4 (rs4680), has been reported to result in a 3- to 4-fold reduction in COMT activity (7, 8), although another study suggested that the difference in catalytic activity might be less significant (9). Given the importance of CYP1B1 and COMT in estrogen metabolism, it is biologically possible that polymorphisms of these genes that lead to an increase in CYP1B1 activity and a decrease in COMT activity may influence an individual's susceptibility to the risk of endometrial cancer.

We tested this hypothesis by examining five putative functional polymorphisms of the CYP1B1 and COMT genes using data from a recently completed population-based case-control study of endometrial cancer conducted in Shanghai, China.


   Materials and Methods
Top
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Detailed study methods have been published previously (10). In brief, this study includes 1,204 incident cases who were between 30 and 69 years of age at diagnosis and 1,212 randomly selected, age-frequency matched population controls. All study participants were interviewed in person by trained interviewers using a standardized and structured questionnaire. The response rates were 82.8% for cases and 74.4% for controls. In addition to the in-person interview, 10-mL blood samples were obtained from 860 cases (71.4%) and 861 (71.0%) controls. The samples were collected in vacutainer tubes containing EDTA and processed typically within 6 hours of blood draw. The buffy coat (WBC) samples were distributed into 2-mL vials and stored at –70°C. For those who did not donate a blood sample at baseline, we collected a sample of exfoliated buccal cells using a modified mouthwash method (16.5% of cases and 16.7% of controls). All collected mouth-rinse samples were processed within 6 hours of collection, and the cell pellet for each subject was stored in two 2-mL vials at –70°C. As such, a DNA sample was available for 86.5% of cases and 85.2% of controls.

The allelic discrimination of the CYP1B1 and COMT polymorphisms were assessed with the ABI PRISM 7900 Sequence Detection System (Applied Biosystems, Foster City, CA) using the Taqman genotyping assay with primers and probes obtained from ABI. The Taqman assay method has been described previously (11), and the assay IDs or primers/probes information are listed in Appendix A. The fluorescence level was measured with the ABI PRISM 7900HT sequence detector (Applied Biosystems). Allele frequencies were determined by ABI SDS software. The laboratory staff were blind to the identity of the subjects. Quality control samples were included in the genotyping assays. The concordance rates for the quality control samples were 97.4% (38 of 39) for COMT rs6269 and 100% for all other single nucleotide polymorphisms (SNP).

The {chi}2 test was used to compare the distributions of CYP1B1 and COMT alleles and genotypes in cases and controls. The exact {chi}2 goodness-of-fit test was used to test Hardy-Weinberg equilibrium of the genotypes. Haplotypes were estimated using PHASE software via a Bayesian method (12). Unconditional logistic regression was employed to estimate the odds ratios and 95% confidence intervals for the associations of CYP1B1 and COMT genotypes with endometrial cancer risk. Interactions between gene-gene and genotype-estrogen exposures were evaluated by constructing a multiplicative term in the logistic regression model. All the analyses were adjusted by age. Potential confounding effects from other demographic factors and known endometrial cancer risk factors, such as educational level, body mass index, age at menarche, age at menopause, parity, and oral contraceptive use, were also examined, and no appreciable confounding was observed.


   Results
Top
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
The distributions of selected demographic characteristics and major risk factors of endometrial cancer among cases and controls have been reported elsewhere (10). Briefly, cases and controls had similar age distribution. Compared with controls, cases had an earlier age at menarche, later age at menopause, and longer duration of menstruation. Cases were more likely to have a higher educational level and a higher body mass index or waist-hip ratio; to have a family history of colorectal, endometrial, or breast cancer among first-degree relatives; to be nulliparous; and to have never used oral contraceptives. Subjects with genotyping data were representative of all participants in the study with regard to the distribution of major demographic and risk factors.

The frequencies of alleles and common haplotypes of CYP1B1 and COMT polymorphisms among cases and controls are shown in Table 1 . All CYP1B1 and COMT SNPs were in Hardy-Weinberg equilibrium among both cases and controls. The common alleles in CYP1B1 among controls were 81.7% for rs10012, 87.9% for rs1056836, and 87.9% for rs1056837. Variant alleles at rs1056836 and rs1056837 were in strong linkage disequilibrium (Lewontin's D' = 1.00; correlation, r = 0.99). Among controls, the frequencies of common COMT alleles were 72.8% for rs4680 and 64.1% for rs6269. The most common haplotype for CYP1B1 rs10012, rs1056836, and rs1056837 was C-C-C with the estimated frequencies of 70.5% among cases and 71.5% among controls. Overall, the frequency differences of CYP1B1 and COMT polymorphism and CYP1B1 haplotype between cases and controls were not statistically significant.


View this table:
[in this window]
[in a new window]

  		Table 1. Allele frequencies (%) of the CYP1B1 and COMT genes and haplotype distribution of CYP1B1 polymorphisms, the Shanghai Endometrial Cancer Study

 
We did not find significant associations of CYP1B1 and COMT genotypes with endometrial cancer risk (Table 2 ). Analyses stratified by menopausal status showed similar results, and no interaction between menopausal status and genotype was evident (all Ps for interaction tests were > 0.05). We also examined the interaction of CYP1B1 and COMT genotypes with estrogen-related factors, such as body mass index, waist-hip ratio, years of menstruation, and oral contraceptive use, and found no significant interaction (data not shown).


View this table:
[in this window]
[in a new window]

  		Table 2. Associations between CYP1B1 and COMT genotypes and endometrial cancer risk

 
The likelihood ratio test was done to explore the relationship between common CYP1B1 haplotypes and endometrial cancer risk, pooling all haplotypes with frequencies <5% into a single category. Using the most common haplotype, which contains wild alleles at rs1002, rs1056836, and rs1056837 as the reference group, we did not find an association between CYP1B1 haplotypes and endometrial cancer (data not shown).

We further explored the joint effect of two SNPs of the COMT gene on endometrial cancer risk. Comparing genotype AA with the GG/AG genotypes for SNP rs4680 among subjects carrying none or one variant allele in rs6269, the odds ratio (95% confidence interval) was 1.29 (0.92-1.82). Among women with none or one variant allele in rs4680, the odds ratio (95% confidence interval) was 1.05 (0.81-1.27) for the GG genotype in SNP rs6269 compared with the AA/AG genotypes. Similarly, using women carrying none or one variant allele in CYP1B1 SNPs rs10012, rs1056836, and rs1056837 as the reference group, odds ratios (95% confidence interval) were 0.77 (0.48-1.23) for women carrying any one of the homozygous variant-type alleles of CYP1B1 SNPs and 0.50 (0.24-1.03) for women carrying any two of the homozygous variant-type alleles. Finally, we examined the potential interactive effect between CYP1B1 and COMT genotypes and no significant interaction was observed.


   Discussion
Top
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Laboratory studies have shown that both CYP1B1 and COMT are expressed in the endometrium (1, 7, 13). CYP1B1 and COMT are involved in the hydroxylation and conjugation of estradiol and thus may be important factors contributing to host susceptibility to endometrial cancer. CYP1B1 variants are more efficient than wild types in the conversion and accumulation of carcinogenic catechol estrogens (1). The COMT variants, on the other hand, are associated with a reduction of inactivating catechol estrogens to nongenotoxic methylethers (7, 8). Therefore, it is biologically possible that women with the variant genotypes of CYP1B1 and COMT may have a greater risk of endometrial cancer.

Polymorphisms of CYP1B1 have been investigated in relation to breast, ovarian, and endometrial cancers with conflicting results (3, 8, 9, 14, 15). In our large-scale, case-control study conducted in Shanghai, we found that CYP1B1 SNPs in codons 48, 119, and 432 were not associated with breast cancer risk (15). Four epidemiologic studies, mostly conducted in Caucasians, which have investigated CYP1B1 gene polymorphisms in relation to endometrial cancer risk in recent years have resulted in mixed findings (16-19). Rylander-Rudqvist et al. found no overall association between the CYP1B1 codon 48, 119, and 453 genotypes and endometrial cancer risk (16). Similarly, Doherty et al. reported no strong alteration in risk among women with the CYP1B1 codon 432 variant alleles (17). However, in a nested case-control study, McGrath et al. reported that a decreased risk of endometrial cancer was associated with the CYP1B1 codon 453 variant allele (odds ratio, 0.62; 95% confidence interval, 0.42-0.91; ref. 18) but not with the CYP1B1 codon 432 polymorphism. A case-control study that included 113 Japanese endometrial cancer patients and 100 healthy female controls observed a significantly increased risk of endometrial cancer associated with the CYP1B1 codon 119 and 432 polymorphisms (19). Although our results differ from the findings of the small-scale Japanese study (19), our results are consistent with most previous studies (16-18), depicting no association of endometrial cancer risk with CYP1B1 genotypes.

We did not find any association between COMT rs4680 and rs6269 genotypes and the risk of endometrial cancer. Previous studies investigating the relationship of COMT rs4680 genotype and hormone-related cancers have had inconsistent results (9, 15, 17, 18, 20). McGrath et al. did not observe an association between the COMT rs4680 genotype and endometrial cancer (18), whereas Doherty et al. reported that the low-activity allele was associated with a slightly decreased risk of endometrial cancer (17). The inconsistency in study findings may result from the ethnic differences of the study populations and the limitations of the study designs. One recent study also suggested that other functional variations, especially regulatory variations, might exist and that COMT haplotypes could be used to ascertain the effect of COMT on disease etiology (21). Results from another study showed that CpG hypermethylation could selectively inactivate COMT, leading to the accumulation of catechol estrogens and promotion of endometrial carcinogenesis (22).

Chinese women typically have a low level of circulating estrogen (23), which might mask the effect of estrogen metabolic gene polymorphisms. We conducted analyses among women with conditions related to a high level or long period of estrogen exposure, such as women with high body mass index/waist-hip ratio and longer durations of menstruation. However, we failed to find any gene-environment interactions with the above factors.

Strengths of this study include the population-based study design and large sample size, which minimized selection bias and led to relatively stable risk estimation. The detailed exposure information enabled an evaluation of gene-environment interactions. Nevertheless, the statistical power in subgroups of our study remained limited due to the low frequencies of variant alleles, which prevented our ability to identify weak associations. The study applied the candidate gene approach, which primarily focuses on the potential function of common genetic variants (>5%) and SNPs with amino acid changes. However, we cannot rule out the possibility that SNPs of CYP1B1 and COMT other than those included in our study may be related to the risk of endometrial cancer. Given that multiple genes are involved in estrogen biosynthesis and metabolism (24, 25), the confounding and/or modifying effects of other genes also cannot be excluded.

In summary, we found no strong evidence that common polymorphisms of the CYP1B1 and COMT genes play a major role in the development of endometrial cancer among Chinese women.


Appendix A. Summary of the genotyping assays of CYP1B1 and COMT polymorphisms

Gene SNP Primer sequence (5'-3') Probe sequence (5'-3')
CYP1B1 R48G (rs10012) F, GCTGCTGAGGCAACGGA VIC, CAGCTCCGGTCCGC
R, CAGTGGCCACGCAAACG FAM, AGCTCGGGTCCGC
V432L (rs1056836) F, GATCAAAGTTCTCCGGGTTAGG VIC, ATGACCCACTGAAGTG
R, TTTGTCAACCAGTGGTCTGTGAAT FAM, ATGACCCAGTGAAGTG
D449D (rs1056837) ABI Assay ID: C_3099975_20 ABI Assay ID: C_3099975_20
V158M (rs4680) F, CCCAGCGGATGGTGGAT VIC, TTCGCTGGCATGAAG
R, CAGGCATGCACACCTTGTC FAM, TCGCTGGCGTGAAG
rs6259 ABI Assay ID: C_2538746_1_ ABI Assay ID: C_2538746_1_

Abbreviations: F: forward; R: reverse.


   Acknowledgments
 
We thank Dr. Fan Jin for her contributions in implementing the study in Shanghai and Bethanie Hull and Brandy Bentley for technical support in article preparation. This study would not have been possible without the support of all of the study participants and research staff of the Shanghai Endometrial Cancer Study.


   Footnotes
 
Grant support: National Cancer Institute/USPHS grant R01CA92585.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 6/14/06; revised 9/15/06; accepted 10/10/06.


   References
Top
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hanna IH, Dawling S, Roodi N, Guengerich FP, Parl FF. Cytochrome P450 1B1 (CYP1B1) pharmacogenetics: association of polymorphisms with functional differences in estrogen hydroxylation activity. Cancer Res 2000;60:3440–4.[Abstract/Free Full Text]
  2. Newbold RR, Liehr JG. Induction of uterine adenocarcinoma in CD-1 mice by catechol estrogens. Cancer Res 2000;60:235–7.[Abstract/Free Full Text]
  3. Bailey LR, Roodi N, Dupont WD, Parl FF. Association of cytochrome P450 (CYP1B1) polymorphism with steroid receptor status in breast cancer. Cancer Res 1998;58:5038–41.[Abstract/Free Full Text]
  4. Stoilov I, Akarsu AN, Alozie I. Sequence analysis and homology modeling suggest that primary congenital glaucoma on 2p21 results from mutations disrupting either the hinge region or the conserved core structures of cytochrome P450 1B1. Am J Hum Genet 1998;62:573–84.[CrossRef][Medline]
  5. Aklillu E, Oscarson M, Hidestrand M, Leidvik B, Otter C, Ingelman-Sundberg M. Functional analysis of six different polymorphic CYP1B1 enzyme variants found in an Ethiopian population. Mol Pharmacol 2002;61:586–94.[Abstract/Free Full Text]
  6. Dawling S, Roodi N, Mernaugh RL, Mernauqh RL, Wang X, Parl FF. Catechol-O-methyltransferase (COMT)-mediated metabolism of catechol estrogens: comparison of wild-type and variant COMT isoforms. Cancer Res 2001;61:6716–22.[Abstract/Free Full Text]
  7. Goodman JE, Jensen LT, He P, Yager JD. Characterization of human soluble high and low activity catechol-O-methyltransferase catalyzed catechol estrogen methylation. Pharmacogenetics 2002;12:517–28.[CrossRef][Medline]
  8. Saintot M, Malaveille C, Hautefeuille A, Gerber M. Interactions between genetic polymorphism of cytochrome P450–1B1, sulfotransferase 1A1, catechol-O-methyltransferase and tobacco exposure in breast cancer risk. Int J Cancer 2003;107:652–7.[CrossRef][Medline]
  9. Goodman JE, Lavigne JA, Hengstler JG, Tanner B, Helzlsouer KJ, Yager JD. Catechol-O-methyltransferase polymorphism is not associated with ovarian cancer risk. Cancer Epidemiol Biomarkers Prev 2000;9:1373–6.[Abstract/Free Full Text]
  10. Tao MH, Xu WH, Zheng W, et al. Oral contraceptive and IUD use and endometrial cancer: A population-based case-control study in Shanghai, China. Int J Cancer 2006;119:2142–7.[Medline]
  11. Cai Q, Shu XO, Wen W, et al. Functional Ser326Cys polymorphism in hOGG1 genes is not associated with breast cancer risk. Cancer Epidemiol Biomarkers Prev 2006;15:403–4.[Free Full Text]
  12. Stephens M, Smith NJ, Donnelly P. A new statistical method for haplotype reconstruction from population data. Am J Hum Genet 2001;68:978–89.[CrossRef][Medline]
  13. Vadlamur SV, Glover DD, Turner T, Sarkar MA. Regiospecific expression of cytochrome P4501A1 and 1B1 in human uterine tissue. Cancer Lett 1998;122:143–50.[CrossRef][Medline]
  14. Sellers TA, Schildkraut JM, Pankratz VS, et al. Estrogen bioactivation, genetic polymorphisms, and ovarian cancer. Cancer Epidemiol Biomarkers Prev 2005;14:2536–43.[Abstract/Free Full Text]
  15. Wen WQ, Cai QY, Shu XO, et al. Cytochrome P450 1B1 and catechol-O-methyltransferase genetic polymorphisms and breast cancer risk in Chinese women: results from the Shanghai Breast Cancer Study and a meta-analysis. Cancer Epidemiol Biomarkers Prev 2005;14:329–35.[Abstract/Free Full Text]
  16. Rylander-Rudqvist T, Wedren S, Jonasdottir G, et al. Cytochrome P450 1B1 gene polymorphisms and postmenopausal endometrial cancer risk. Cancer Epidemiol Biomarkers Prev 2004;13:1515–20.[Abstract/Free Full Text]
  17. Doherty JA, Weiss NS, Freeman RJ, et al. Genetic factors in catechol estrogen metabolism in relation to the risk of endometrial cancer. Cancer Epidemiol Biomarkers Prev 2005;14:357–66.[Abstract/Free Full Text]
  18. McGrath M, Hankinson SE, Arbeitman L, Colditz GA, Hunter DJ, De Vivo I. Cytochrome P450 1B1 and catechol-O-methyltransferase polymorphisms and endometrial cancer susceptibility. Carcinogenesis 2004;25:559–65.[Abstract/Free Full Text]
  19. Sasaki M, Tanaka Y, Kaneuchi M, Sakuragi N, Dahiya R. CYP1B1 gene polymorphisms have higher risk for endometrial cancer, and positive correlations with estrogen receptor a and estrogen receptor ß expressions. Cancer Res 2003;63:3913–8.[Abstract/Free Full Text]
  20. Cheng TC, Chen ST, Huang CS, et al. Breast cancer risk associated with genotype polymorphism of catechol estrogen-metabolizing genes: a multigenic study on cancer susceptibility. Int J Cancer 2005;113:345–53.[CrossRef][Medline]
  21. DeMille MM, Kidd JR, Ruggeri V, et al. Population variation in linkage disequilibrium across the COMT gene considering promoter region and coding region variation. Hum Genet 2002;111:521–37.[CrossRef][Medline]
  22. Sasaki M, Kaneuchi M, Sakuragi N, Dahiya R. Multiple promoters of catechol-O-methyltransferase gene are selectively inactivated by CpG hypermethylation in endometrial cancer. Cancer Res 2003;63:3101–6.[Abstract/Free Full Text]
  23. Randolph JF, Jr., Sowwers M, Bondarenko IV, Harlow SD, Luborsky JL, Little RJ. Change in estradiol and follicle-stimulating hormone across the early menopausal transition: effects of ethnicity and age. J Clin Endocrinol Metab 2004;89:1555–61.[Abstract/Free Full Text]
  24. Dunning AM, Dowsett M, Healey CS, et al. Polymorphisms associated with circulating sex hormone levels in postmenopausal women. J Natl Cancer Inst 2004;96:936–45.[Abstract/Free Full Text]
  25. Tworoger SS, Chubak J, Aiello EJ, et al. Association of CYP17, CYP19, CYP1B1, and COMT polymorphisms with serum and urinary sex hormone concentrations in postmenopausal women. Cancer Epidemiol Biomarkers Prev 2004;13:94–101.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Cancer Epidemiol. Biomarkers Prev.Home page
S. L. Deming, W. Zheng, W.-H. Xu, Q. Cai, Z. Ruan, Y.-B. Xiang, and X.-O. Shu
UGT1A1 Genetic Polymorphisms, Endogenous Estrogen Exposure, Soy Food Intake, and Endometrial Cancer Risk
Cancer Epidemiol. Biomarkers Prev., March 1, 2008; 17(3): 563 - 570.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tao, M. H.
Right arrow Articles by Shu, X. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tao, M. H.
Right arrow Articles by Shu, X. O.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online