
Cancer Epidemiology Biomarkers & Prevention Vol. 15, 2002-2005, October 2006
© 2006 American Association for Cancer Research
Death Receptor 4 Variants and Colorectal Cancer Risk
Bernd Frank1,4,
Kalai Selvi Shanmugam1,4,
Lars Beckmann2,
Kari Hemminki1,6,
Hermann Brenner3,5,
Michael Hoffmeister3,5,
Jenny Chang-Claude2 and
Barbara Burwinkel1,4
Divisions of 1 Molecular Genetic Epidemiology, 2 Clinical Epidemiology, and 3 Clinical Epidemiology and Aging Research and 4 Helmholtz-University Group Molecular Epidemiology, German Cancer Research Center, Heidelberg, Germany; 5 Department of Epidemiology, German Centre for Research on Ageing, Heidelberg, Germany; and 6 Center for Family Medicine, Karolinska Institute, Huddinge, Sweden
Requests for reprints: Bernd Frank, Division of Molecular Genetic Epidemiology, German Cancer Research Center, Im Neuenheimer Feld 580, 69120 Heidelberg, Germany. Phone: 49-6221-421461; Fax: 49-6221-421455. E-mail: b.frank{at}dkfz.de
 |
Abstract
|
|---|
The tumor necrosis factorrelated apoptosis-inducing ligand receptor modulates apoptotic response by binding to the proapoptotic death receptor 4 (DR4). Perturbed apoptosis due to missense alterations in the candidate tumor suppressor gene DR4 leads to deregulated cell proliferation and cancer predisposition. Recent studies have discussed the association of DR4 variants with cancer risk. We evaluated, for the first time, the role of the Thr209Arg (626C>G) and Glu228Ala (683A>C) polymorphisms on colorectal cancer risk by genotyping 659 incident cases and 607 healthy controls drawn from the German population-based Darmkrebs: Chancen der Verhütung durch Screening (DACHS) study. Whereas DR4 Glu228Ala was not associated with colorectal cancer, Thr209Arg heterozygotes were at a significantly decreased colorectal cancer risk [odds ratio (OR), 0.73; 95% confidence interval (95% CI), 0.54-0.97]. Stratification according to sex and age exhibited a significant association of Thr209Arg with a decreased risk for male heterozygotes (OR, 0.68; 95% CI, 0.46-0.99) and for Arg209 carriers
65 years of age (OR, 0.65; 95% CI, 0.46-0.92) as well as an enhanced risk for female Ala228 carriers in a allele dose-dependent manner (Ptrend = 0.01). Subsite analysis revealed a protective effect of Thr209Arg for rectal cancer risk (OR, 0.67; 95% CI, 0.48-0.95) and a significant risk increase for Ala228 carriers with advanced colorectal cancer stages (Ptrend = 0.04). Haplotype analysis revealed a 2.4-fold risk for carriers of the rare 626C-683C haplotype (1% prevalence in the general population; OR, 2.37; 95% CI, 0.98-5.76). The score statistic yielded an empirical P of 0.03 of the haplotype-specific test for 626C-683C based on 20,000 simulations, suggesting that DR4 626C-683C may affect colorectal cancer predisposition. (Cancer Epidemiol Biomarkers Prev 2006;15(10):20025)
 |
Introduction
|
|---|
Apoptosis or programmed cell destruction is a key regulator of tissue homeostasis. An imbalance between cell death and proliferation may result in tumor formation. The tumor necrosis factorrelated apoptosis-inducing ligand (TRAIL) activates the extrinsic apoptotic pathway through the engagement of the proapoptotic death receptor 4 (DR4, TNFRSF10A, TRAILR-1), a member of the tumor necrosis factor receptor superfamily. DR4 consists of two extracellular cysteine-rich, ligand-binding pseudorepeats (50s and 90s loops), one single transmembrane helix as well as the apoptosis-triggering cytoplasmic death domain. Suppression of cell death signaling due to detrimental alterations in DR4 involves a deregulated cell proliferation and predisposes to cancer (1-6).
Immunohistochemical studies have shown extensive expression of DR4 both in sporadic and hereditary colorectal neoplasms together with a higher degree of apoptosis, suggesting neoplastic colorectal cells to be prone to TRAIL-induced apoptosis (5, 6). Moreover, Drosopoulos et al. (7) have reported the induction of cell death in human colon adenocarcinoma cells in a mitogen-activated protein kinase/extracellular signal-regulated kinase kinasedependent manner by TRAIL. Mutations in DR4, mapping to chromosome 8p21-22, have been described in several human cancers, such as breast, lung, head and neck cancer, and non-Hodgkin's lymphoma (8-10), but have not yet been studied in colorectal cancer. However, frequent loss of heterozygosity on chromosome 8p21-23 has been observed in hepatocellular carcinoma as well as in colorectal cancer, pointing to DR4 as a candidate tumor suppressor gene for both cancers (11).
Recently, we have investigated the effects of DR4 Thr209Arg (626C>G) and Glu228Ala (683A>C) on familial breast cancer risk (12). Although neither variant showed significance regarding disease risk, the analysis of the rare haplotype 626C-683C resulted in an increased risk of breast cancer (12).
Given these findings, we estimated the colorectal cancer risk associated with the DR4 Thr209Arg and Glu228Ala variants in a German population-based case-control study.
 |
Materials and Methods
|
|---|
Study Population
Colorectal cancer cases and controls were drawn from the German Darmkrebs: Chancen der Verhütung durch Screening (DACHS) study, a large population-based case-control study carried out in the Rhine-Neckar-Odenwald region in the southwest of Germany (13). The cases consisted of 659 unrelated male and female subjects (33-91 years of age; median 68) with incident invasive colorectal cancer diagnosed between January 2003 and March 2005. The median time between diagnosis and ascertainment of the cases was 14 days. Detailed information is given in Table 1
. The control group comprised 607 unrelated male and female individuals (34-94 years of age; median 67). None of the controls had a personal history of colorectal cancer. They were randomly selected from lists of population registries and frequency-matched to cases by 5-year age groups, sex, and county of residence. Cases and controls were eligible if they were aged 30 years and above, German-speaking, and mentally and physically capable of participating in an in-person interview of about 1 hour. A detailed description of the study population is given in Table 1. The study was approved by the Ethics Committees of the University of Heidelberg and the State Medical Boards of Baden-Wuerttemberg and Rhineland-Palatinate (Germany).
Data Collection
Details of the data collection procedures are reported elsewhere (13-15). In brief, study subjects were asked to participate in an in-person interview and to give a blood sample or a mouthwash when blood samples were not available. Information on demographic factors, anthropometric measures, medical history, including medication and screening, family history of colorectal cancer, reproductive history, and lifestyle factors were collected by trained interviewers using a standardized questionnaire.
Single Nucleotide Polymorphism Selection
Based on our previous results for familial breast cancer (12), we selected and analyzed the effects of DR4 Thr209Arg (rs4871857) and Glu228Ala (rs17088993) on colorectal cancer risk. In the single nucleotide polymorphism database, there are five additional coding single nucleotide polymorphisms in DR4: Thr33Ile (rs20577), Pro105Arg (rs11986840), His141Arg (rs6557634), Asn297His (rs17088980), and Arg441Lys (rs2230229). To validate these variants, we sequenced 20 randomly selected breast cancer DNA samples (12). DR4 His141Arg was not analyzed because, according to Fisher et al. (9), it segregated together with Thr209Arg in 96% of their samples (n = 243). None of the investigated variants, except for DR4 Arg441Lys, could be confirmed. The rare Arg441Lys was shown not to segregate with the high-risk haplotype 626C-683C and therefore not expected to be disease-causing.
Detection of DR4 Thr209Arg and Glu228Ala Genotypes
Blinded genotyping was done by TaqMan allelic discrimination. TaqMan primers and probes were provided by the Assay-by-Design service (Applied Biosystems, Foster City, CA) and designed based on the Genbank NT_023666 sequence. Sequences of primers and probes were as follows: Thr209Arg, GGTGGTGAGGAAAGGTCAAG (forward) and ATGGGGTCAGGGCTGATAG (reverse), VIC-TCTCACCCTGTGCTGC, and FAM-TCTCACCCTCTGCTGC; Glu228Ala, CCCCTGCAGATACGAGGAG (forward) and caggaaaagacaggagtctcg (reverse), VIC-TGACATCGAGTGTGTCC, and FAM-CATCGCGTGTGTCC. Detailed information about sequencing and TaqMan allelic discrimination methods have been described previously (12, 16). To ensure accuracy and to exclude genotyping error,
10% of samples were re-genotyped. The duplicates showed a concordance rate of 100%.
Statistics
Genotype-specific odds ratios (OR), 95% asymptotic confidence intervals (95% CI), and Ps were computed by unconditional logistic regression using a tool offered by the Institute of Human Genetics, Technical University Munich (Munich, Germany).7 Hardy-Weinberg equilibrium test was undertaken using Pearson's goodness-of-fit
2 test with 1 degree of freedom.
Adjustment for sex and age and the two-sided Cochran-Armitage test for trend were done using the Statistical Analysis System software (version 9.1; SAS Institute, Inc., Cary, NC). The Cochran-Armitage statistic was used to test for trend in genetic ORs with increasing stage. We used the software package haplo.stats to test for association of indirectly deduced haplotypes (17, 18). It does the joint modeling of observed multipoint single nucleotide polymorphism genotype and phenotype, using a generalized linear model framework to test for haplotype-trait association and to calculate ORs and 95% CIs. The most common haplotype was chosen as the reference group. To account for the uncertainty of the haplotype estimation, each haplotype pair, consistent with the genotype of an individual and weighted by its estimated probability, is used to model the individual's phenotype. To support our findings, we derived empirical Ps for haplotype-trait association under an additive model, using the score statistic implemented in haplo.score, based on 20,000 simulations.
 |
Results and Discussion
|
|---|
Genotype frequencies for both polymorphisms analyzed were in agreement with Hardy-Weinberg expectations in controls (P = 0.48 for Thr209Arg and P = 0.55 for Glu228Ala, respectively). Although there were no significant differences in genotype frequencies between colorectal cancer cases and controls for DR4 Glu228Ala (683A>C; OR, 1.19; 95% CI, 0.94-1.50; Table 2
), heterozygous carriers of DR4 Thr209Arg (626C>G) showed a significant association with a decreased colorectal cancer risk (OR, 0.73; 95% CI, 0.54-0.97; Table 2). The risk, however, did not decrease with the number of variant alleles, which may point to a finding by chance. Adjustment for sex and age made no relevant difference to the findings. The allele frequencies for both single nucleotide polymorphisms among cases and controls were consistent with the allele frequencies reported in Caucasian populations (9, 12). Stratification by sex and age revealed a significant association of DR4 Thr209Arg with a decreased colorectal cancer risk for male heterozygotes (OR, 0.68; 95% CI, 0.46-0.99; Table 2). Because the association was independent of allele dosis (Table 2), it may be a chance finding. DR4 Glu228Ala showed an increased colorectal cancer risk for females in an allele dose-dependent manner (OR, 1.52; 95% CI, 1.04-2.22 and OR, 1.95; 95% CI, 0.80-4.77; Ptrend = 0.01; Table 2) as well as a decreased risk for Arg209 carriers
65 years (OR, 0.65; 95% CI, 0.46-0.92; Table 2), the equivalent of an increased risk for homozygote carriers of the common C allele (Thr209). Analysis by subsite showed the same effect on rectal cancer risk (OR, 0.67; 95% CI, 0.48-0.95; Table 3
). Moreover, the risk associated with the DR4 Glu228Ala variant increased with advanced colorectal cancer stages, revealing a significant risk for Ala228 carriers (OR, 1.40; 95% CI, 1.04-1.86; Ptrend = 0.04; Table 3), which may be a sign of a greater tumor aggressiveness in Ala228 (683C) carriers.
View this table:
[in this window]
[in a new window]
|
Table 2. Genotype frequencies of DR4 Thr209Arg (626C>G) and Glu228Ala (683A>C) in colorectal cancer patients and controls (stratified by sex and age), OR with 95% CIs and respective Ps
|
|
View this table:
[in this window]
[in a new window]
|
Table 3. Genotype frequencies of DR4 Thr209Arg (626C>G) and Glu228Ala (683A>C) in colorectal cancer cases and controls, ORs with 95% CIs and respective Ps
|
|
When analyzing haplotypes, the results from logistic regression pointed to a haplotype effect (global P = 0.07). The combination of DR4 Thr209Arg and Glu228Ala led to four distinct haplotypes (Table 4
). In the generalized linear model framework, 626C-683A, 626G-683A, and 626G-683C haplotypes showed no association with colorectal cancer. The rare haplotype 626C-683C was found to be more common in cases than in controls, resulting in an increased colorectal cancer risk (OR, 2.37; 95% CI, 0.98-5.76; P = 0.06; Table 4). The score statistic yielded a significant empirical P of 0.03, based on 20,000 simulations, for 626C-683C. The identification of the 626C-683C haplotype as risk factor for colorectal cancer is in line with our recently published findings on familial breast cancer risk (626C-683C: OR, 3.52; ref. 12). Because both DR4 Thr209Arg and Glu228Ala reside next to the DR4 TRAIL-binding ectodomain, the observed association may be due either to the joint effects of Thr209 and Ala228 by altering ligand-binding and thus apoptotic signaling or to an unknown causative variant in strong linkage disequilibrium with the haplotype.
View this table:
[in this window]
[in a new window]
|
Table 4. Haplotype distributions and frequencies of DR4 Thr209Arg (626C>G) and Glu228Ala (683A>C) in patients with colorectal cancer and control individuals
|
|
In summary, we detected a significant association of the DR4 Thr209Arg variant with a decreased colorectal cancer risk for heterozygotes and Arg209 carriers
65 years of age. Female Ala228 variant carriers exhibited a significantly enhanced risk dependent on allele dose. Subsite analysis revealed a protective effect of Arg209 on rectal cancer risk as well as an increased risk for advanced colorectal cancer stages. In addition, the DR4 626C-683C haplotype conferred a 2.4-fold colorectal cancer risk, suggesting its relevance in human cancer.
Our results on DR4 variants and colorectal cancer risk are explorative. Given the modest stratum-specific Ps for association, they may be artifacts due to multiple testing and need confirmation in larger studies.
 |
Acknowledgments
|
|---|
We thank the clinicians who supported the study, all patients and control individuals who participated in the study, Belinda-Su Kaspereit for technical assistance, and Kerstin Wagner for critical comments on the article.
 |
Footnotes
|
|---|
Grant support: German Research Council (Deutsche Forschungsgemeinschaft) grants BR 1704/6-1, BR 1704/6-3, CH 117/1-1, and CH 117/3-1 (Darmkrebs: Chancen der Verhütung durch Screening study and L. Beckmann).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
7 http://ihg.gsf.de/cgi-bin/hw/hwa1.pl. 
Received 1/24/06;
revised 7/17/06;
accepted 8/10/06.
 |
References
|
|---|
- Evan GI, Vousden KH. Proliferation, cell cycle, and apoptosis in cancer. Nature 2001;411:3428.[CrossRef][Medline]
- Bouralexis S, Findlay DM, Evdokiou A. Death to the bad guys: targeting cancer via Apo2L/TRAIL. Apoptosis 2005;10:3551.[CrossRef][Medline]
- Hengartner MO. The biochemistry of apoptosis. Nature 2000;407:7706.[CrossRef][Medline]
- Hymowitz SG, Christinger HW, Fuh G, et al. Triggering cell death: the crystal structure of Apo2L/TRAIL in a complex with death receptor 5. Mol Cell 1999;4:56371.[CrossRef][Medline]
- Koornstra JJ, Jalving M, Rijcken FE, et al. Expression of tumour necrosis factor-related apoptosis-inducing ligand death receptors in sporadic and hereditary colorectal tumours: potential targets for apoptosis induction. Eur J Cancer 2005;41:1195202.[CrossRef][Medline]
- Koornstra JJ, Kleibeuker JH, van Geelen CM, et al. Expression of TRAIL (TNF-related apoptosis-inducing ligand) and its receptors in normal colonic mucosa, adenomas, and carcinomas. J Pathol 2003;200:32735.[CrossRef][Medline]
- Drosopoulos KG, Roberts ML, Cermak L, et al. Transformation by oncogenic RAS sensitizes human colon cells to TRAIL-induced apoptosis by up-regulating death receptor 4 and death receptor 5 through a MEK-dependent pathway. J Biol Chem 2005;280:2285667.[Abstract/Free Full Text]
- Seitz S, Wassmuth P, Fischer J, et al. Mutation analysis and mRNA expression of trail-receptors in human breast cancer. Int J Cancer 2002;102:11728.[CrossRef][Medline]
- Fisher MJ, Virmani AK, Wu L, et al. Nucleotide substitution in the ectodomain of trail receptor DR4 is associated with lung cancer and head and neck cancer. Clin Cancer Res 2001;7:168897.[Abstract/Free Full Text]
- Lee SH, Shin MS, Kim HS, et al. Somatic mutations of TRAIL-receptor 1 and TRAIL-receptor 2 genes in non-Hodgkin's lymphoma. Oncogene 2001;20:399403.[CrossRef][Medline]
- Emi M, Fujiwara Y, Nakajima T, et al. Frequent loss of heterozygosity for loci on chromosome 8p in hepatocellular carcinoma, colorectal cancer, and lung cancer. Cancer Res 1992;52:536872.[Abstract/Free Full Text]
- Frank B, Hemminki K, Shanmugam KS, et al. Association of death receptor 4 haplotype 626-683C with an increased breast cancer risk. Carcinogenesis 2005;26:19757.[Abstract/Free Full Text]
- Brenner H, Chang-Claude J, Seiler CM, Sturmer T, Hoffmeister M. Does a negative screening colonoscopy ever need to be repeated? Gut 2006;55:114550.[Abstract/Free Full Text]
- Frank B, Hemminki K, Brenner H, Hoffmeister M, Chang-Claude J, Burwinkel B. ARLTS1 variants and risk of colorectal cancer. Cancer Lett. Epub 2006 Feb 16.
- Lilla C, Verla-Tebit E, Risch A, et al. Effect of NAT1 and NAT2 genetic polymorphisms on colorectal cancer risk associated with exposure to tobacco smoke and meat consumption. Cancer Epidemiol Biomark Prev 2006;15:99107.[Abstract/Free Full Text]
- Frank B, Hemminki K, Wirtenberger M, et al. The rare ERBB2 variant Ile654Val is associated with an increased familial breast cancer risk. Carcinogenesis 2005;26:6437.[Abstract/Free Full Text]
- Lake SL, Lyon H, Tantisira K, et al. Estimation and tests of haplotype-environment interaction when linkage phase is ambiguous. Hum Hered 2003;55:5665.[CrossRef][Medline]
- Schaid DJ, Rowland CM, Tines DE, Jacobson RM, Poland GA. Score tests for association between traits and haplotypes when linkage phase is ambiguous. Am J Hum Genet 2002;70:42534.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
K. S. Shanmugam, H. Brenner, M. Hoffmeister, J. Chang-Claude, and B. Burwinkel
The functional genetic variant Arg324Gly of frizzled-related protein is associated with colorectal cancer risk
Carcinogenesis,
September 1, 2007;
28(9):
1914 - 1917.
[Abstract]
[Full Text]
[PDF]
|
 |
|