
Cancer Epidemiology Biomarkers & Prevention Vol. 14, 1350-1352, May 2005
© 2005 American Association for Cancer Research
Microsomal Epoxide Hydrolase Polymorphisms Are Not Associated with Colon Cancer Risk
Kim Robien1,2,
Karen Curtin3,
Cornelia M. Ulrich1,2,
Jeannette Bigler1,
Wade Samowitz4,
Bette Caan5,
John D. Potter1,2 and
Martha L. Slattery3
1 Cancer Prevention Program, Public Health Sciences Division, Fred Hutchinson Cancer Research Center; 2 Department of Epidemiology, University of Washington, Seattle, Washington; Departments of 3 Family and Preventive Medicine, and 4 School of Medicine, University of Utah Health Sciences Center, Salt Lake City, Utah; and 5 Division of Research, Kaiser Permanente Medical Care Program, Oakland, California
Requests for reprints: Cornelia M. Ulrich, Cancer Prevention Program, Fred Hutchinson Cancer Research Center, P.O. Box 19024, M4-B402, Seattle, WA 98109-1024. Phone: 206-667-7617; Fax: 206-667-7850. E-mail: krobien{at}fhcrc.org
 |
Introduction
|
|---|
Epidemiologic studies have implicated exposure to tobacco smoke and high intakes of cooked, broiled, or well-done meats in the increased risk of colorectal cancers (1-4). Microsomal epoxide hydrolase (mEH) is a phase II biotransformation enzyme which detoxifies epoxides, including carcinogens such as polycyclic aromatic hydrocarbons found in cigarette smoke and cooked meats (5). A tyrosine to histidine substitution in exon 3 (Y113H) of the mEH gene decreases in vitro enzyme activity by 40%, whereas a histidine to arginine substitution in exon 4 (H139R) increases in vitro enzyme activity by 25% (6). Smaller epidemiologic studies evaluating the relationship between the mEH polymorphisms and risk of colorectal cancer and its precursors have been inconclusive (7-9). We evaluated the risk of colon cancer associated with both the mEH Y113H and H139R genotypes in a large case-control study.
 |
Materials and Methods
|
|---|
Methods for selection of cases and controls and data collection have been described in detail elsewhere (10-12). Briefly, participants were subjects from the Kaiser Permanente Medical Care Program of Northern California, an eight-county area in Utah, and the metropolitan Twin Cities area of Minnesota. Eligibility criteria have been previously described (10). Controls who had never had a previous colorectal tumor were selected from Kaiser Permanente Medical Care Program membership lists in California; driver's license lists, random-digit-dialing, or Centers for Medicare and Medicaid Services lists for Utah; and driver's license or state identification lists in Minnesota.
mEH Genotyping
The mEH Y113H, H139R polymorphisms were detected using the 5' nuclease assay on a 7900HT sequence detection system (Applied Biosystems, Foster City, CA). Primers and probes and PCR core reagents were purchased from Applied Biosystems. The assays were validated by genotyping 100 individuals by both 5' nuclease assay and RFLP or sequencing. There were no discrepancies between the two assays. Genotyping was done in 20 µL reactions containing 1x Taqman PCR core reagents 4 mmol/L MgCl2, 200 nmol/L primers (Y113H: 5'CTGGAAGAAGCAGGTGGAGATT3', 5'TGGCTGGCGTTTTGCAA3'; H139R: 5'TCCACCCTGACTGTGCTCTGT3', 5'TGGGATGATCTTATAAAACTCGTAGAAA3'), 100 nmol/L probes (Y113: VIC-5'TCAACAGATACCCTCACT3'-NFQ; 113H: 6FAM-5'AACAGACACCCTCACT3'-NFQ; H139: VIC-5'CAGGCCATACCCCGA3'_NFQ; 139R: FAM-5'AGGCCGTACCCCGA3'-NFQ), and 3 ng DNA. Amplification cycles were 50°C for 5 minutes, 95°C for 10 minutes, and 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. Positive controls for all the genotypes and reagent controls were included in each plate. Genotyping of 94 randomly selected samples was repeated for each polymorphism. There were no discrepancies.
Statistical Methods
Unconditional logistic regression models were used. Multivariate adjustment included age, sex, body mass index (kg/m2), vigorous physical activity index (13), regular use of aspirin or nonsteroidal anti-inflammatory drugs, and usual number of cigarettes smoked per day. This study had 90% power to detect an odds ratio (OR) of 1.4 for the main effect comparing homozygous wild-type mEH 113YY with homozygous variant mEH 113HH genotype, and 80% power to detect an OR of 1.4 for the equivalent comparison within the H139R genotype.
 |
Results
|
|---|
Of 4,403 eligible participants with valid data for the study, 3,553 participants with available DNA (1,593 cases and 1,960 controls) were genotyped for both the mEH Y113H and H139K polymorphisms. Characteristics of the study population have been described elsewhere (14). Genotype frequencies for both the Y113H and H139K polymorphic sites were in Hardy-Weinberg equilibrium among the controls and among the cases, and did not vary significantly between cases and controls. Frequencies for both the Y113H H allele (0.27 for cases; 0.32 for controls) and H139K K allele (0.17 for cases; 0.22 for controls) are consistent with previously reported genotype frequencies (7, 8, 15-19).
Risks of colon cancer associated with the Y113H and H139K genotypes, combined genotypes, and imputed phenotypes as proposed by Smith and Harrison (19) are summarized in Table 1. Greater usual number of cigarettes smoked increased risk of colon cancer overall, especially when restricted to microsatellite instabilitypositive colon cancers; however, tests for trend did not identify significant differences by mEH Y113H or H139R genotypes. The risk estimates did not vary significantly when stratified by total mutagen index (20), dietary intake of red or white meat, tumor site (proximal versus distal), or genotype for the NAT2, GSTM1, or CYP1A1 biotransformation enzymes (data not shown).
 |
Discussion
|
|---|
Previous reports evaluating the association between mEH Y113H genotype and colorectal cancer have been contradictory. Harrison et al. (7) reported that the 113HH genotype was associated with an increased risk of colon cancer (OR, 3.8; 95% confidence interval, 1.8-8.0), whereas Sachse et al. (9) found the 113HH genotype to be associated with a decreased risk of colorectal cancer (OR, 0.7; 95% confidence interval, 0.5-0.95). Controls for the studies by Sachse et al. (9) and Harrison et al. (7) were not in Hardy-Weinberg equilibrium for the Y113H polymorphism, as has been frequently reported in studies using PCR-RFLP mEH Y113H genotyping methods (6, 9, 16). Neither group evaluated whether environmental factors such as smoking or well-cooked meat intake modified their findings.
With regard to the H139R polymorphism, analyses by Harrison et al. (7), Sachse et al. (9), and Mitrou et al. (8) all failed to find an association between genotype and risk of colorectal cancer. However, among smokers, Mitrou et al. reported an increased risk of colorectal and distal colon cancers with the 139RR genotype (OR, 2.9; 95% confidence interval, 1.3-6.0 and OR, 3.7; 95% confidence interval, 1.6-8.2, respectively).
Both Sachse et al. (9) and Harrison et al. (7) reported a significant difference in Y113H genotype frequencies between cases and controls, suggesting that Y113H genotype may be a susceptibility factor in the development of colorectal cancer. These findings of an altered risk were not confirmed in our study, and may be partially attributable to the fact that the previous studies included cases of rectal cancers, whereas rectal cancer was an exclusion criterion for our study.
It would be expected that mEH genotypes would alter risk of colon cancer under specific conditions such as exposure to cigarette smoke and dietary mutagens. However, most of the previous studies did not explore these interactions. This study, which found no association between mEH Y113H or H139R genotype and colon cancer risk, is the largest to date, and included evaluation of exposure to cigarette smoke and well-cooked meats. Although we did not observe any difference by mEH genotype, environmental exposure to cigarette smoke and dietary mutagens have predicted risk of colon cancer and adenomatous and hyperplastic polyps in our past research (15, 20-22).
Studies of adenomatous polyps, possible precursors of colorectal cancer, have similarly failed to find an association between mEH genotype and risk of polyps. However, some have observed interactions with smoking and cooked meat by mEH genotype (15, 16, 23, 24).
We conclude that the mEH Y113H and H139R genotypes do not affect risk of colon cancer, and may only be a factor in the development of adenomatous polyps (earlier stages of colon carcinogenesis) under conditions of elevated carcinogen exposure.
 |
Acknowledgments
|
|---|
We thank Juanita Leija for technical assistance with the mEH genotype determinations.
 |
Footnotes
|
|---|
Grant support: NIH research grants CA48998, CA59045, and CA61757 and National Cancer Institute training grant R25 CA94880 (K. Robien).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 11/30/04;
accepted 1/17/05.
 |
References
|
|---|
- Potter JD. Colorectal cancer: molecules and populations. J Natl Cancer Inst 1999;91:91632.[Abstract/Free Full Text]
- Sinha R, Rothman N. Role of well-done, grilled red meat, heterocyclic amines (HCAs) in the etiology of human cancer. Cancer Lett 1999;143:18994.[CrossRef][Medline]
- Sinha R, Chow WH, Kulldorff M, et al. Well-done, grilled red meat increases the risk of colorectal adenomas. Cancer Res 1999;59:43204.[Abstract/Free Full Text]
- Cross AJ, Sinha R. Meat-related mutagens/carcinogens in the etiology of colorectal cancer. Environ Mol Mutagen 2004;44:4455.[CrossRef][Medline]
- Seidegard J, DePierre JW. Microsomal epoxide hydrolase. Properties, regulation and function. Biochim Biophys Acta 1983;695:25170.[Medline]
- Hassett C, Aicher L, Sidhu JS, Omiecinski CJ. Human microsomal epoxide hydrolase: genetic polymorphism and functional expression in vitro of amino acid variants. Hum Mol Genet 1994;3:4218.[Abstract/Free Full Text]
- Harrison DJ, Hubbard AL, MacMillan J, Wyllie AH, Smith CA. Microsomal epoxide hydrolase gene polymorphism and susceptibility to colon cancer. Br J Cancer 1999;79:16871.[CrossRef][Medline]
- Mitrou P, Watson M, Bingham S, Stebbings WS, Speakman CT, Loktionov A. NQO1 and mEH exon 4 (mEH4) gene polymorphisms, smoking and colorectal cancer risk. IARC Sci Publ 2002;156:4957.[Medline]
- Sachse C, Smith G, Wilkie MJ, et al. A pharmacogenetic study to investigate the role of dietary carcinogens in the etiology of colorectal cancer. Carcinogenesis 2002;23:183949.[Abstract/Free Full Text]
- Slattery ML, Potter J, Caan B, et al. Energy balance and colon cancerbeyond physical activity. Cancer Res 1997;57:7580.[Abstract/Free Full Text]
- Slattery ML, Caan BJ, Duncan D, Berry TD, Coates A, Kerber R. A computerized diet history questionnaire for epidemiologic studies. J Am Diet Assoc 1994;94:7616.[CrossRef][Medline]
- Edwards S, Slattery ML, Mori M, et al. Objective system for interviewer performance evaluation for use in epidemiologic studies. Am J Epidemiol 1994;140:10208.[Abstract/Free Full Text]
- Slattery ML, Edwards SL, Ma KN, Friedman GD, Potter JD. Physical activity and colon cancer: a public health perspective. Ann Epidemiol 1997;7:13745.[CrossRef][Medline]
- Curtin K, Bigler J, Slattery ML, Caan B, Potter JD, Ulrich CM. MTHFR C677T and A1298C polymorphisms: diet, estrogen, and risk of colon cancer. Cancer Epidemiol Biomarkers Prev 2004;13:28592.[Abstract/Free Full Text]
- Ulrich CM, Bigler J, Whitton JA, Bostick R, Fosdick L, Potter JD. Epoxide hydrolase Tyr113His polymorphism is associated with elevated risk of colorectal polyps in the presence of smoking and high meat intake. Cancer Epidemiol Biomarkers Prev 2001;10:87582.[Abstract/Free Full Text]
- Cortessis V, Siegmund K, Chen Q, et al. A case-control study of microsomal epoxide hydrolase, smoking, meat consumption, glutathione S-transferase M3, and risk of colorectal adenomas. Cancer Res 2001;61:23815.[Abstract/Free Full Text]
- Jourenkova-Mironova N, Mitrunen K, Bouchardy C, Dayer P, Benhamou S, Hirvonen A. High-activity microsomal epoxide hydrolase genotypes and the risk of oral, pharynx, and larynx cancers. Cancer Res 2000;60:5346.[Abstract/Free Full Text]
- Tiemersma EW, Omer RE, Bunschoten A, et al. Role of genetic polymorphism of glutathione-S-transferase T1 and microsomal epoxide hydrolase in aflatoxin-associated hepatocellular carcinoma. Cancer Epidemiol Biomarkers Prev 2001;10:78591.[Abstract/Free Full Text]
- Smith CA, Harrison DJ. Association between polymorphism in gene for microsomal epoxide hydrolase and susceptibility to emphysema. Lancet 1997;350:6303.[CrossRef][Medline]
- Kampman E, Slattery ML, Bigler J, et al. Meat consumption, genetic susceptibility, and colon cancer risk: a United States multicenter case-control study. Cancer Epidemiol Biomarkers Prev 1999;8:1524.[Abstract/Free Full Text]
- Slattery ML, Potter JD, Samowitz W, Bigler J, Caan B, Leppert M. NAT2, GSTM-1, cigarette smoking, and risk of colon cancer. Cancer Epidemiol Biomarkers Prev 1998;7:107984.[Abstract]
- Potter JD, Bigler J, Fosdick L, et al. Colorectal adenomatous and hyperplastic polyps: smoking and N-acetyltransferase 2 polymorphisms. Cancer Epidemiol Biomarkers Prev 1999;8:6975.[Abstract/Free Full Text]
- Tiemersma EW, Kloosterman J, Bunschoten A, Kok FJ, Kampman E. Role of EPHX genotype in the associations of smoking and diet with colorectal adenomas. IARC Sci Publ 2002;156:4913.[Medline]
- Tranah GJ, Giovannucci E, Ma J, Fuchs C, Hankinson SE, Hunter DJ. Epoxide hydrolase polymorphisms, cigarette smoking and risk of colorectal adenoma in the Nurses' Health Study and the Health Professionals Follow-up Study. Carcinogenesis 2004;25:12118.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
P. N. Mitrou, M. A. Watson, A. S. Loktionov, C. Cardwell, M. J. Gunter, W. S. Atkin, C. P. Macklin, T. Cecil, D.T. Bishop, J. Primrose, et al.
Role of NQO1C609T and EPHX1 gene polymorphisms in the association of smoking and alcohol with sporadic distal colorectal adenomas: results from the UKFSS Study
Carcinogenesis,
April 1, 2007;
28(4):
875 - 882.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. L. Goode, J. D. Potter, W. R. Bamlet, D. N. Rider, and J. Bigler
Inherited variation in carcinogen-metabolizing enzymes and risk of colorectal polyps
Carcinogenesis,
February 1, 2007;
28(2):
328 - 341.
[Abstract]
[Full Text]
[PDF]
|
 |
|