
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
1 Division of Molecular Epidemiology, National Center for Toxicological Research, Jefferson, Arkansas; 2 Central Arkansas Veteran's Health Care System; 3 Arkansas Cancer Research Center; and 4 Department of Surgery, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, Arkansas; 5 Department of Epidemiology, Roswell Park Cancer Institute, Buffalo, New York; and 6 BioServe Biotechnologies, Inc., Laurel, Maryland
Requests for reprints: Angie Stone, Central Arkansas Veteran's Health Care System, Research Service Slot 151, 4301 West 7th Street, Little Rock, AR 72205. Phone: 501-257-4850; Fax: 501-257-4822. E-mail: Stoneannjanette{at}uams.edu
| Abstract |
|---|
|
|
|---|
-imino acid, with alanine, an amino acid, could be of biochemical significance. In a case-control study with 490 incident prostate cancer cases (124 African Americans and 358 Caucasians) and 494 controls (167 African Americans and 319 Caucasians), we examined the association between CYP3A43 Pro340Ala polymorphism and prostate cancer risk. When all subjects were considered, there was a 3-fold increase in risk of prostate cancer among individuals with the CYP3A43-Ala/Ala genotype (odds ratio, 3.0; 95% confidence interval, 1.2-7.2) compared with those with the CYP3A43-Pro/Pro genotype after adjusting for age, race, and smoking. The prevalence of the polymorphism was significantly higher in African Americans than Caucasians (45% versus 13%). In African Americans, there was a 2.6-fold increase in prostate cancer risk among individuals with the CYP3A43-Ala/Ala genotype (odds ratio, 2.6; 95% confidence interval, 1.0-7.0) compared with those with the CYP3A43-Pro/Pro genotype. Among Caucasians, the small number of homozygotes precluded computing risk estimates; there were only three individuals with the CYP3A43-Ala/Ala genotype. Our results suggest that the CYP3A43-Pro340Ala polymorphism contributes to prostate cancer risk. | Introduction |
|---|
|
|
|---|
Members of the cytochrome P450 (CYP) family of enzymes, which are responsible for >50% of drug metabolism, are heme-containing mono-oxygenases that catalyze hydroxylation of steroids (including testosterone, progesterone, and cortisol) and xenobiotics (12). The CYP3A family is composed of four known CYP3A genes in humans: CYP3A4, CYP3A5, CYP3A7, and CYP3A43. Each gene contains 13 exons and is located on chromosome 7q21-22.1, with CYP3A43 in an unusual head-to-head orientation with CYP3A4, CYP3A5, and CYP3A7 (13, 14). CYP3A43 shares DNA sequence homologies of 84%, 83%, and 82% and amino acid homologies of 76%, 76%, and 72% with CYP3A4, CYP3A5, and CYP3A7, respectively (13, 15).
Distribution of CYP3A43 mRNA in various tissues (liver, kidney, pancreas, prostate, etc.) by PCR amplification has shown that the expression level of CYP3A43 is considerably lower than CYP3A4, CYP3A5, and CYP3A7, although the level of expression of CYP3A43 does not necessarily reflect the extent of its actual role in xenobiotic metabolism (15). Westlind et al. found that CYP3A43 and CYP3A4 mRNA are expressed in prostate, colon, breast, lung, and pancreatic carcinoma; there is also some evidence of hepatic coexpression of all four mRNAs (12). Three different transcript variants are formed from alternate splicing of this gene. Interestingly, there are several hybrid CYP3A43/CYP3A4 and CYP3A43/CYP3A5 genes that have been formed by splicing CYP3A43 exon 1 to various CYP3A4 or CYP3A5 exons, resulting in hybrid mRNA products (13). The chimeric proteins formed from these transgenic splicing variants are not always enzymatically active; however, the longest chimeric isoform, encoded by the (1)CYP3A43-(2-13)CYP3A4 cDNA, can hydroxylate testosterone (13).
Xenobiotics and endogenous substances, such as steroid hormones, can activate the pregnane X receptor, a human orphan nuclear receptor, resulting in the induction of CYP3A genes. Two drugs known to induce CYP3A activity in primary hepatocytes are rifampicin and dexamethasone; however, the four CYP3A isoforms differed in expression levels when other drugs were used, indicating that the four isoforms are differentially regulated (14-16). In addition, there is very little sequence similarity among the 5' untranslated regions of CYP3A43 and CYP3A4, CYP3A5, and CYP3A7 genes; regulatory elements in the 5' region of CYP3A43 have not been found, although CYP3A4 has several known regulatory regions and binding sites in the 5' untranslated region (17).
Several studies have addressed the hypothesis that functional polymorphisms in the CYP3A4 and CYP3A5 genes could be associated with prostate cancer risk among different ethnic populations. Rebbeck et al. found that an A-to-G mutation within the nifedipine-specific element, 293 bp from the transcription start site of the CYP3A4 gene, was associated with higher grade and stage in Caucasians with prostate cancer (18). Additional studies found evidence that African Americans possess the CYP3A4*1B (variant allele) at 6 to 10 times the frequency found in Caucasians; limited data support the hypothesis that the variant allele alters testosterone metabolism (19-21). The CYP3A5 6986 G > A (CYP3A5*3) variant correlates with function of the CYP3A5 enzyme and is in linkage disequilibrium with the CYP3A4 promoter variant and possibly other alleles (22). Plummer et al. found that the CYP3A4*1B/CYP3A5*3 haplotype (which is more common in African Americans than Caucasians) is positively associated with prostate cancer, but the CYP3A4*1B variant is inversely associated with risk among Caucasians with less aggressive disease (23).
Recently, three polymorphisms in the coding region of the CYP3A43 gene have been confirmed: a silent substitution in exon 11 (c.1047 C > T; designated CYP3A43*1B), a frameshift mutation in exon 2 (c.74delA; designated CYP3A43*2A), and a missense mutation in exon 10 (c.1018C > G; designated CYP3A43*3; ref. 24). Because the CYP3A43*3 genotype is most likely associated with changes in function, we investigated the association between CYP3A43*3 genotype and prostate cancer risk in a case-control study consisting of both African Americans and Caucasians.
| Materials and Methods |
|---|
|
|
|---|
80% of Arkansas residents. Sixty-eight percent of the controls were from the mass mail database (Caucasians 62% and African Americans 71%), 14% of the controls were from a Centers for Medicare and Medicaid Services database (Caucasians 21% and African Americans 16%), and 19% of the controls were from the driver's license database (Caucasians 21% and African Americans 16%). Study controls were frequency matched to cases on age (±5 years) and race. Exclusion criteria for the case-control study included a history of cancer (except nonmelanoma skin cancer), uncontrolled cardiovascular disease, and hepatic dysfunction (as determined by bilirubin >1.5 mg/dL, aspartate aminotransferase >40 units/L, alkaline phosphatase >140 units/L, and abnormal renal function as determined by blood urea nitrogen >20 mg/dL and serum creatinine >1.8 mg/dL). Covariate data for the current study were obtained by conducting in-person interviews with cases and controls at the time of enrollment to the case-control study. Each study participant also provided a blood sample for DNA analyses. The appropriate institutional review board approvals were obtained for the study protocol. Signed informed consent was obtained for the interview, blood collection, and analyses of polymorphisms.
Genotyping
DNA was extracted from lymphocytes of study participants using a commercial kit (Qiagen, Inc., Valencia, CA) and the samples were genotyped for the CYP3A43*3 polymorphism at a commercial laboratory (BioServe Biotechnologies Ltd., Laurel, MD) by high-throughput, chip-based matrix-assisted laser desorption time-of-flight mass spectrometry (Sequenom, Inc., San Diego, CA) using the MassEXTEND reaction (Sequenom). PCR primers and extension primers were designed using SpectroDESIGNER software (Sequenom) and synthesized at BioServe Biotechnologies. Oligonucleotide sequences of the primers and probe were forward primer ACGTTGGATGCATTCTTGCTGAGGC, reverse primer ACGTTGGATGCCTGATGTCCAGCAGAAAC, and extension primer TCATCCCCTTACCTTATTGG.
All laboratory personnel were blinded to case-control status. Forty-four blinded duplicates were included in the genotype analyses and were 100% concordant.
Statistical Analysis
The Wilcoxon rank-sum test was used for continuous variables to test that the distribution of subject characteristics was the same for cases and controls. The
2 test was used for categorical variables. Hardy-Weinberg equilibrium was assessed using
2 tests. Unconditional logistic regression was used to compute odds ratios (OR) and 95% confidence intervals to estimate relative risk of prostate cancer associated with genotypes. The variables used in the multivariate analyses were pack-years of smoking as a continuous variable, age at diagnosis for cases and at interview for controls as a continuous variable, and race as a categorical variable. Potential confounding of the association between genotype and cancer risk by potential risk factors was explored using Spearman rank correlation analyses and multivariate logistic regression models, including stepwise regression models both before and after stratification. If the potential confounder caused a significant change in the log likelihood estimate (P < 0.05) and a >20% change in the B coefficient, it was kept in the model for further multivariate analyses. Modification of the association between genotype and prostate cancer odds by smoking, age, and race (Ps for interactions) was examined by statistical tests of the first-order interaction term in the logistic regression models. Throughout the article, all Ps shown are two sided. All statistical analyses were done using the software package Stata (Stata Corp., College Station, TX).
| Results |
|---|
|
|
|---|
2 tests and we found no deviation from equilibrium. There was a significant difference (P < 0.008) in the distribution of CYP3A43 genotype comparing prostate cancer cases with controls, with the CYP3A43-Ala/Ala genotype being more prevalent in the cases compared with controls (5% and 2%, respectively).
|
|
| Discussion |
|---|
|
|
|---|
-imino acid, with alanine, an amino acid, could have implications for structural integrity or less efficient folding of the protein, thereby reflecting differences in specific activity between the wild-type and the mutant forms. Glykos et al. showed that a single alanine-to-proline substitution was sufficient for changing the topology of a small protein by changing the "surface properties of the protein and the packing of its hydrophobic core while retaining some of the biological activity of the wild-type molecule" (25). One known function of the CYP3A43 wild-type protein is conversion of free testosterone to 6-ß-hydroxytestosterone, resulting in testosterone inactivation (15). We hypothesize that the variant allele (Ala/Ala) decreases CYP3A43 protein activity, thereby reducing 6-ß-hydroxytestosterone oxidation; therefore, more circulating testosterone is available for conversion to its active form, dihydrotestosterone. Some studies have found a correlation between prostate cancer risk and elevated circulating testosterone levels in high-risk African American men (26-30). However, functional studies on both wild-type and variant forms of the CYP3A43 enzyme are necessary to elucidate the biological mechanisms contributing to the increased risk of prostate cancer found in this study. In addition, other functional studies of substrates in both androgen and estrogen pathways need to be investigated, because CYP3A43 seems to differ structurally from the other CYP3A family members in substrate recognition sites SRS-1 to SRS-6 (31). Cigarette smoking is one putative environmental risk factors for prostate cancer; cigarette smoking has been associated with higher levels of testosterone and lower levels of estradiol in men (32). Because testosterone can enhance cell proliferation in the prostate, and estrogens can reduce testicular androgen production, the necessary hormonal environment may be produced to promote prostate cancer initiation (33). In a population-based, case-control study with Caucasians and African Americans, Plaskon et al. found that smoking status was a moderate risk factor for prostate cancer (33). In addition, this study found that the relative risk significantly increased with >40 years duration and with >40 pack-years of exposure. In our study population, cigarette smoking is also a risk factor for prostate cancer (Table 1). However, the majority of studies conducted to date suggest that smoking is not associated with increased risk of prostate cancer (34-36). On the other hand, smoking has been noted to increase prostate cancer mortality (37, 38). We found a statistically significant association between CYP3A43-Ala/Ala genotype and prostate cancer odds among smokers (OR, 8.55; 95% confidence interval, 1.06-68.99) after adjusting for age and pack-years of smoking; however, the 95% confidence interval is quite wide. Nevertheless, this study needs to be replicated in much larger population-based studies of prostate cancer with racially diverse populations because the prevalence of the CYP3A43-Ala/Ala genotype is <10% in both Caucasians and African Americans.
Study results may be affected by sources of bias that may affect case-control studies, including recall, misclassification, and selection bias. The in-person interview and in-depth assessment of histories is likely to reduce recall bias to some extent as well as the fact that cases were interviewed as soon after diagnosis as possible. Regarding misclassification, we have confidence in classification of genotypes that were in Hardy-Weinberg equilibrium and were identified using the very accurate matrix-assisted laser desorption time-of-flight technology. Although there is always the possibility that controls could have undiagnosed prostate cancer, we conducted prostate-specific antigen assays on all control participants and excluded all men whose values were >4 ng/mL. It is more difficult to exclude the possibility of selection bias in case-control studies, although there should be no differential participation based on genotypes; thus, selection bias should not affect the main effects of the genetic variants. Because of the small proportion of men homozygous for the variant allele, larger studies with more African American and Caucasian men are needed; however, this is one of the first studies to evaluate CYP3A43, a gene likely to be important in testosterone metabolism.
Our laboratory is in the process of measuring plasma levels of circulating hormones so that we can evaluate the association between CYP3A43*3 genotype and steroid hormones. For example, levels of testosterone, its precursor androsterone, and its major metabolite dihydrotestosterone vary considerably when stratifying by race, age, and smoking status. In the population-based case-control study, Plaskon et al. (33) measured serum total testosterone and sex hormone binding globulin levels in current smokers and nonsmokers in the control group; they found significantly higher levels of testosterone and sex hormone binding globulin in current smokers.
Because several CYP3A genes play an essential role in steroid and drug metabolism, are candidate genes for prostate cancer risk, and are in close proximity to the CYP3A43 gene, linkage disequilibrium studies need to be done between the CYP3A43 Pro340Ala variant and known functional allelic variants in the CYP3A4, CYP3A5, and CYP3A7 genes. Prostate cancer risk may not be directly associated with the CYP3A43 gene but rather the CYP3A43 gene may be in linkage disequilibrium with other member(s) of the CYP3A family that are the actual causative agent(s). For example, Zeigler-Johnson et al. did not find any association between CYP3A5 known functional variants and prostate cancer risk; however, when CYP3A4/CYP3A5 haplotypes were evaluated, an inverse relationship was found with prostate cancer (39). Comprehensive analysis of the relationship between the CYP3A family and prostate cancer risk is further complicated by the high frequency of alternatively spliced CYP3A43 mRNA variants, which may generate protein isoforms that function differently from the canonical protein.
In conclusion, we report one of the first case-control studies to associate polymorphisms in the CYP3A43 gene with prostate cancer susceptibility. Our results indicate that the CYP3A43 Pro340Ala polymorphism prevalence differs by race and contributes to prostate cancer risk in African Americans. Because African Americans have the highest incidence and mortality rates from prostate cancer in the world, the study of polymorphisms that differ in prevalence by race, such as the CYP3A43 Pro340Ala polymorphism, provide an opportunity to foster insights into prostate cancer risk disparities. A key focus area in our research group is the study of these polymorphisms and prostate cancer susceptibility. Haplotype and linkage analyses of polymorphisms in the CYP3A4, CYP3A5, and CYP3A43 genes may further elucidate relationships between variants in the CYP3A family and prostate cancer risk. Studies are also under way in our laboratory to elucidate the functional significance of the CYP3A43 Pro340Ala change.
| Acknowledgments |
|---|
| Footnotes |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 7/19/04; revised 11/ 4/04; accepted 12/ 2/04.
| References |
|---|
|
|
|---|
-helical bundle with a single amino acid substitution. Structure 1999;7:597603.[Medline]
-Reductase activity and risk of prostate cancer among Japanese and US white and black males. Lancet 1992 Apr 11;339:8879.
This article has been cited by other articles:
![]() |
J. Park, L. Chen, L. Ratnashinge, T. A. Sellers, J.-P. Tanner, J.-H. Lee, N. Dossett, N. Lang, F. F. Kadlubar, C. B. Ambrosone, et al. Deletion Polymorphism of UDP-Glucuronosyltransferase 2B17 and Risk of Prostate Cancer in African American and Caucasian Men. Cancer Epidemiol. Biomarkers Prev., August 1, 2006; 15(8): 1473 - 1478. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Cell Growth & Differentiation |