CEBP CTRC-AACR San Antonio Breast Cancer Symposium Cancer Health Disparities Conference 2009
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Allen, N. E.
Right arrow Articles by Key, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Allen, N. E.
Right arrow Articles by Key, T. J.
Cancer Epidemiology Biomarkers & Prevention Vol. 10, 185-189, March 2001
© 2001 American Association for Cancer Research

The Association between Polymorphisms in the CYP17 and 5{alpha}-Reductase (SRD5A2) Genes and Serum Androgen Concentrations in Men1

Naomi E. Allen2,,3, Matthew S. Forrest4 and Timothy J. Key3

Imperial Cancer Research Fund Cancer Epidemiology Unit, Oxford, United Kingdom OX2 6HE


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Prospective studies suggest that prostate cancer risk may be increased in association with high serum concentrations of free testosterone and androstanediol glucuronide (A-diol-g). Polymorphisms have been identified in the 17-hydroxylase cytochrome P450 gene (CYP17) and the steroid 5{alpha}-reductase type II gene (SRD5A2), two genes that are involved in the biosynthesis and metabolism of androgens in men. The CYP17 MspA1 I polymorphism has been associated with increased prostate cancer risk, and the SRD5A2 V89L polymorphism has been associated with low A-diol-g in Asian men, a serum marker of 5{alpha}-reductase activity. The purpose of this study was to investigate the association between these two polymorphisms and serum sex hormone concentrations in 621 British men. In particular, we wanted to test the hypotheses that the A2 allele in the CYP17 gene is associated with increased serum testosterone concentrations, and the L allele in the SRD5A2 gene is associated with reduced A-diol-g concentrations. Mean hormone concentrations were evaluated in each genotype and adjusted for age and other relevant factors. We found no evidence that the CYP17 MspA1 I polymorphism was associated with higher testosterone levels. The L/L genotype of the SRD5A2 V89L polymorphism was associated with a 10% lower A-diol-g concentration, but this was not significant at the 5% level. However, the L/L genotype of the V89L polymorphism was associated with significantly lower concentrations of testosterone and free testosterone (by 12% and 16%, respectively) and an 8% higher sex hormone-binding globulin concentration. These results suggest that the CYP17 MspA1 I polymorphism is not associated with testosterone concentrations and that the SRD5A2 V89L polymorphism is not a strong determinant of A-diol-g concentration in Caucasian men.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Testosterone and its metabolite DHT5 are crucial for the growth and development of the prostate gland (1) . Prospective studies suggest that prostate cancer risk may be increased in association with high serum concentrations of bioavailable testosterone (2) and A-diol-g, a serum marker of 5{alpha}-reductase activity and intraprostatic DHT (3) . Little is known about the determinants of circulating concentrations of sex hormones and their related proteins in men other than age, body mass index (4 , 5) , and ethnicity (6 , 7) . Genetic polymorphisms that encode for key enzymes involved in androgen biosynthesis and metabolism have been of much epidemiological interest in their relation to hormone-dependent cancer risk (8, 9, 10, 11) . However, their role in determining endogenous hormone concentrations has been little studied.

The cytochrome P450c17{alpha} (CYP17) gene, located on chromosome 10q24.3, codes for the cytochrome P450c17{alpha} enzyme, which catalyzes 17{alpha}-hydroxylase and 17,20-lyase activity at key points in steroid hormone biosynthesis in both sexes. A T to C transition has been described in the 5' untranslated region that creates an additional Sp-1 type (CCACC) motif and a MspA1 I restriction enzyme site (12) . Although the effect of this base change on gene expression is unknown, the variant C allele (designated A2) might result in increased transcriptional activity and, hence, increased biosynthesis of testosterone (12) . The A2 allele has been associated with male pattern baldness in men and polycystic ovarian syndrome in women (12) , conditions that are associated with high androgen concentrations. The A2 allele has been associated with an increased prostate cancer risk in Caucasian men (9 , 10) , although not all of the studies have found this (11) . The A2 allele has also been associated with elevated levels of estradiol, an important conversion product of the P450c17{alpha} enzyme in women (13 , 14) , although the evidence that this polymorphism affects breast cancer risk is also conflicting (8 , 14, 15, 16) .

The 5{alpha}-reductase type II (SRD5A2) gene, located on chromosome 2p23, encodes the enzyme that catalyzes the irreversible conversion of testosterone to DHT within prostatic cells. The SRD5A2 V89L polymorphism is caused by a G to C transversion that results in the substitution of valine for leucine at codon 89 (denoted the L allele). The distribution of the polymorphism appears to parallel prostate cancer risk between different ethnic groups, with Caucasian and African-American men having a low prevalence of the L allele (24% and 22%, respectively), compared with a prevalence of 46% among Asian men (17) . The L/L genotype was associated with a significantly lower mean serum A-diol-g concentration within the Asian men, suggesting that the L allele may reduce 5{alpha}-reductase activity (17) . However, this polymorphism has not been found to be significantly associated with prostate cancer risk among Caucasian men (9 , 18) .

This study aimed to investigate the association between these two genetic polymorphisms and serum concentrations of sex hormones and their related proteins in a large group of Caucasian men. In particular, we sought to test the hypotheses that the CYP17 A2 allele is associated with elevated serum testosterone concentrations and that the SRD5A2 L allele is associated with decreased A-diol-g concentrations.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Subjects
This study is part of a larger investigation designed to investigate diet and hormonal function in men, described elsewhere (19) . Briefly, 750 white male subjects were selected from the Oxford, United Kingdom component of the EPIC. These men were recruited throughout the United Kingdom between 1994 and 1997 through vegetarian and health food magazines, the Vegetarian Society, and the Vegan Society and from friends and relatives of the participants. Men were eligible for the current study if they had donated a blood sample before 1998 and had no diagnosis of cancer or any other serious conditions known to influence hormone concentrations.

Blood Collection and Hormone Assays
Blood samples (30 ml) were collected for each subject, sent in the mail to the EPIC laboratory in Norfolk, and aliquoted into 0.5 ml-straws of plasma, serum, buffy coat, and erythrocytes. Samples were stored in liquid nitrogen tanks at -196°C. Immunoassays were used to measure serum testosterone (Immuno 1; BayerCorp, New York, NY), A-diol-g (Diagnostic Systems, Webster, Texas), SHBG (Oy Medix Biochemica Ab, Kauniainen, Finland), and LH (Technicon Immuno 1; BayerCorp) in the Clinical Biochemistry Laboratory at the John Radcliffe Hospital, Oxford, United Kingdom in 1998. Samples were randomly assorted into batches. Coefficients of variation were 6.8% at 10.2 nmol/liter for testosterone, 2.6% at 9.7 nmol/liter for A-diol-g, 9.5% at 31 nmol/liter for SHBG, and 1.7% at 3.7 IU/liter for LH. An estimate of the concentration of FT was derived from the known concentrations of testosterone and SHBG and the assumption that albumin is constant between individuals, using the formula based on the law of mass action (20 , 21) .

Molecular Analyses
DNA was purified from 0.5-ml buffy coat samples of peripheral blood using Nucleon BACC2 kits according to the manufacturer’s instructions (Nucleon ST, Glasgow, Scotland, United Kingdom).

CYP17 Assay.
PCR amplification of the polymorphic fragment was performed using the forward primer 5'-CATTCGCACCTCTGGAGTC-3' and the reverse primer 5'-GGCTCTTGGGGTACTTG-3'(8) . PCR reactions were carried out in 15-µl aliquots containing 50 ng of genomic DNA, 1 µM of each primer, 1 x Perkin-Elmer Buffer II (PE Biosystems) reaction buffer, 1.5 mM MgCl2, 0.4 mM deoxynucleotide triphosphates, and 0.75 units of AmpliTaq Gold polymerase (PE Biosystems). Amplification conditions were 95°C for 10 min, followed by 30 cycles of 94°C for 1 min, 57°C for 1 min, 72°C for 1 min, and a final step at 72°C for 10 min on PE 9700 thermocyclers (PE Biosystems). Products were digested using 1 unit of MspA1 I (New England Biolabs) in 20 µl of 1 x NEBuffer 4 (New England Biolabs) and 1 x BSA at 37°C for 3 h. Products were separated by electrophoresis on 1.5% agarose gels and stained with ethidium bromide to detect the RFLP. Quality control samples were inserted to validate genotype identification procedures.

SRD5A2 Assay.
PCR reactions were performed in 15-µl aliquots containing 50 ng of genomic DNA, 1 x PE Buffer II (Perkin-Elmer Biosystems), 1.5 mM MgCl2, 0.8 mM deoxynucleotide triphosphate (total), 5% DMSO, and 0.2 µM of each primer in 15 µl of water. PCR forward primer SRD5A2415 (TCCAGAAGTTGCCGCATCAG) and reverse primer SRD5A2039 (CGGTGCGCGCTCCAC) were used (9) . Cycle conditions were 95°C for 10 min, followed by 40 cycles of 94°C for 30 s, 65°C for 30 s, 72°C for 30 s, and a final step at 72°C for 10 min on PE 9700 thermocyclers. Products were then digested with 1 unit of RsaI restriction enzyme (New England Biolabs) in 1 x NEBuffer 1 and 1 x BSA in 17-µl volumes overnight at 37°C. Products were separated by electrophoresis on 2% agarose gels and stained with ethidium bromide to detect the RFLPs. Quality control samples were inserted to validate genotype identification procedures.

Statistical Methods
Testosterone, FT, and A-diol-g were square-root transformed, and SHBG and LH were natural-logarithmically transformed to approximate normal distributions to perform ANCOVA. None of the transformed variables was statistically significantly different from a normal distribution at the 5% level according to the Shapiro-Wilk test (Ps were 0.237, 0.069, 0.179, 0.104, and 0.083 for testosterone, FT, A-diol-g, SHBG, and LH, respectively). Back-transformed means and their corresponding 95% confidence intervals are presented. ANCOVA was used to evaluate the association between genotype and circulating hormone concentrations after adjusting for age, time of day at venipuncture, time since last eaten at venipuncture, and time between venipuncture and blood processing. Adjustments for lifestyle factors such as body mass index, smoking, education, dietary group, and exercise were examined but did not effect the point estimates and were not included in the final model. Differences in adjusted mean hormone levels between the genotypes were evaluated using A1/A1 genotype as the reference group for CYP17 and V/V as the reference group for SRD5A2. All of the Ps are derived from parametric tests of heterogeneity derived from ANCOVA models and are taken from the F statistic that all of the underlying group means are equal, unless otherwise stated. A P of less than 0.05 was considered statistically significant, and all of the significance tests were 2-sided. A test for linear trend was also performed, where appropriate, to assess statistical significance across genotypes by incorporating the categorical term in the model as a linear term. All of the statistical analyses were performed using Stata 5.0 (22) .


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The mean age of the subjects was 47 years (range, 20 to 78 years), and the mean body mass index was 24.0 (range, 17.5 to 48.0). One subject was identified as having a nonsense mutation in the SRD5A2 gene c.309-319delGGGACGGTACT, and further examination revealed substantially lower testosterone, FT, and A-diol-g concentration compared with mean values. Therefore, this subject was excluded from both analyses. Genotypes were determined for the CYP17 MspA1 I polymorphism in 621 subjects and for the SRD5A2 V89L polymorphism in 611 subjects. The distributions of the CYP17 and SRD5A2 genotypes are shown in Table 1Citation . Both genotype frequencies were in Hardy-Weinberg equilibrium, with expected frequencies for the CYP17 genotypes being A1/A1 = 259, A1/A2 = 284, and A2/A2 = 78 (P = 0.80); and for the SRD5A2 genotypes, V/V = 316, V/L = 247, and L/L = 48 (P = 0.99). The prevalences of the CYP17 A2 allele and SRD5A2 L allele were 35% and 28%, respectively, and the proportions of homozygotes were 13% for the variant A2 allele in the CYP17 polymorphism and 8% for the variant L allele in the SRD5A2 polymorphism.


View this table:
[in this window]
[in a new window]
 
Table 1 Adjusteda mean hormone concentrations by CYP17 MspA1 I and SRD5A2 V89L polymorphisms in 622 British men

 
The CYP17 polymorphism was not significantly associated with testosterone concentration (test for heterogeneity; P = 0.461), and possession of this polymorphism had no significant effect on the other hormones studied (Table 1)Citation . A-diol-g concentration was not significantly associated with the SRD5A2 polymorphism (test for heterogeneity; P = 0.313), although the mean A-diol-g concentration in the L/L genotype was 10% lower than in the V/V genotype (P = 0.129). A test for linear trend of decreasing A-diol-g levels across genotypes was also not statistically significant (P = 0.230). However, the L/L genotype was associated with a significant 12% reduction in testosterone concentration and a 16% reduction in FT concentration compared with the V/V genotype (test for heterogeneity; P = 0.037 and 0.001, respectively). The mean SHBG concentrations were not significantly different between genotypes (test for heterogeneity; P = 0.093), although the L/L genotype had a significant 13% higher mean SHBG concentration compared with the V/L genotype (P = 0.044). However, the 8% difference in mean SHBG concentration between the V/V and the L/L genotypes was not significant.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Testosterone and its metabolite DHT play a critical role in promoting prostate growth, and the identification of genetically determined differences in androgen metabolism may be important in explaining some of the observed differences in prostate cancer risk between individuals (9) and populations (6 , 17) .

The sample size was large, but the prevalence of the homozygotes for the variant alleles was low (13% and 8%), which may have led to insufficient power to detect a significant difference in mean hormone concentrations between genotypes. Hormone measurements were taken from a single sample for each man, and although a single measure of testosterone has been shown to reliably reflect mean annual testosterone concentrations in middle-aged men (23) , little is known about the long-term reliability of a single serum measurement for other hormones. To ensure that the groups were as comparable as possible, hormone concentrations were adjusted for potential confounding variables including age, time of day at venipuncture, time since last eaten at venipuncture, and time between venipuncture and blood processing. Furthermore, all of the hormone assays were conducted blinded and in randomly assorted order.

This is the first study to report on the association between the CYP17 MspA1 I polymorphism and testosterone concentrations in men. As yet, there is no knowledge whether the A2 allele confers a higher expression of enzyme activity in vivo, although the fact that it does not appear to bind to the transcription site, Sp-1, in an in vitro assay (24) suggests that this polymorphism may not have any functional effect on enzyme activity. Nevertheless, the variant A2 allele has been associated with elevated concentrations of estradiol among premenopausal (13) and postmenopausal women (16) . To date, two case-control studies have found a small but significant increased risk of prostate cancer associated with the A2 allele among Caucasian men (9 , 10) , although a study in Sweden found an increased risk associated with the A1 allele (11) . The results from this present study suggest that this polymorphism is not associated with serum testosterone concentrations in men.

Our findings suggest that the SRD5A2 V89L polymorphism is not a strong determinant of serum 5{alpha}-reductase activity. However, subjects with the L/L genotype had a nonsignificant 10% lower mean A-diol-g concentration compared with men with the V/V genotype. This finding is very similar to that reported among 386 Caucasian men (18) and is consistent with the hypothesis that the variant allele may reduce 5{alpha}-reductase activity. However, there was limited power to detect a small effect on A-diol-g levels as the prevalence of the L allele in this study and other Caucasian populations is low (9 , 17 , 18) . The effect of this polymorphism on A-diol-g levels, therefore, needs to be investigated with a larger sample size or in a population where the prevalence of the L allele is higher, such as among Asian men (17) . Indeed, small differences in serum A-diol-g of 5% (ratio, 1.05; 95% confidence interval, 1.00–1.11) have been found between 644 men who subsequently developed prostate cancer and 1048 healthy individuals in a meta-analysis of prospective studies on sex hormones and prostate cancer (3) . If small differences in serum A-diol-g levels reflect larger differences in intraprostatic androgen activity, then these genetic differences may be of biological relevance to prostate cancer risk. A large prospective study found the L/L genotype to be associated with a 16% nonsignificant reduction in prostate cancer risk (18) , although a case-control study found no association with the L/L genotype and a small increase in prostate cancer risk with the L allele alone among Caucasian men (9) .

The reason why a stronger genetic effect has been observed among Asian men compared with Caucasian men is not clear; it may be attributable to chance, or the V89L polymorphism may be in linkage disequilibrium with a locus involved in androgen metabolism that only exists among Asian populations. Because the V89L, (TA)n, and A49T polymorphisms identified in the SRD5A2 have been shown to vary across racial/ethnic groups (17 , 25 , 26) , this may be a possibility. However, recent data suggest a significant increased risk of early-onset prostate cancer for individuals homozygous for the V89L leucine variant and no association with the (TA)n or the A49T polymorphisms.6 Additional work is needed to establish whether these and other polymorphisms in the SRD5A2 gene are associated with circulating sex hormone concentrations.

Our finding that the SRD5A2 L/L genotype was associated with significantly lower testosterone and FT concentrations was unexpected and not an a priori hypothesis. Indeed, one might expect serum testosterone concentration to increase with the V89L variant because trials of finasteride, a chemical inhibitor of 5{alpha}-reductase, have generally found increased serum concentrations of testosterone (27 , 28) , together with substantial reductions in serum A-diol-g concentrations (29) . Interestingly, Makridakis et al. (17) found no association between the V89L polymorphism and testosterone concentration among Asian men. These unexpected findings should, therefore, be interpreted with caution, especially considering that the effects were small, the Ps for the tests of heterogeneity were of marginal significance, and there is no clear biological mechanism through which a genotype associated with decreased DHT production within the prostate would lead to decreased serum levels of total testosterone and FT. These findings should, therefore, be interpreted with extreme caution and need to be confirmed in other studies.

In summary, these findings suggest that the MspA1 I polymorphism in the CYP17 gene is not associated with testosterone concentrations and that the V89L polymorphism in the SRD5A2 gene is not a strong determinant of A-diol-g concentration in Caucasian men.


    Acknowledgments
 
We thank Prof. Timothy Bishop for his collaboration in the assay techniques and for his helpful comments on the manuscript. We thank all of the participants of the EPIC study, the EPIC study staff at the Imperial Cancer Research Fund, and Dr. Dennis Quantrill and staff at the Clinical Biochemistry laboratory at the John Radcliffe Infirmary, Oxford, United Kingdom.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the Imperial Cancer Research Fund and by the Europe Against Cancer Program of the Commission of the European Communities. Back

2 To whom requests for reprints should be addressed, at Imperial Cancer Research Fund Cancer Epidemiology Unit, Gibson Building, Radcliffe Infirmary, Woodstock Road, Oxford, OX2 6HE, United Kingdom. Phone: 01865-311933; Fax: 01865-301545; E-mail: n.allen{at}icrf.icnet.uk Back

3 Present address: Imperial Cancer Research Fund Cancer Epidemiology Unit, Gibson Building, Radcliffe Infirmary, Woodstock Road, Oxford, OX2 6HE, United Kingdom. Back

4 Present Address: Imperial Cancer Research Fund Genetic Epidemiology Laboratory, Cancer Genetics Building, St. James’s University Hospital, Leeds, LS9 7TF, United Kingdom. Back

5 The abbreviations used are: DHT, dihydrotestosterone; A-diol-g, androstanediol glucuronide; EPIC, European Prospective Investigation into Cancer and Nutrition; SHBG, sex hormone-binding globulin; LH, luteinizing hormone; FT, free testosterone; ANCOVA, analysis of covariance. Back

6 M. S. Forrest, unpublished observations. Back

Received 4/ 5/00; revised 12/ 8/00; accepted 12/15/00.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Wilding G. Endocrine control of prostate cancer. Cancer Surv., 23: 43-62, 1995.[Medline]
  2. Gann P. H., Hennekens C. H., Ma J., Longcope C., Stampfer M. J. Prospective study of sex hormone levels and risk of prostate cancer. J. Natl. Cancer Inst. (Bethesda), 88: 1118-1126, 1996.[Abstract/Free Full Text]
  3. Eaton N. E., Reeves G. K., Appleby P. N., Key T. J. Endogenous sex hormones and prostate cancer: a quantitative review of prospective studies. Br. J. Cancer, 80: 930-934, 1999.[Medline]
  4. Wu A. H., Whittemore A. S., Kolonel L. N., John E. M., Gallagher R. P., West D. W., Hankin J., Teh C. Z., Dreon D. M., Paffenbarger R.S., Jr. Serum androgens and sex hormone binding-globulin in relation to lifestyle factors in older African-American men, white and Asian men in the United States and Canada. Cancer Epidemiol. Biomark. Prev., 4: 735-741, 1995.[Abstract]
  5. Field A. E., Colditz G. A., Willett W. C., Longcope C., McKinlay J. B. The relation of smoking, age, relative weight and dietary intake to serum adrenal steroids, sex hormones and sex hormone binding-globulin in middle-aged men. J. Clin. Endocrinol. Metab., 79: 1310-1316, 1994.[Abstract]
  6. Ross R. K., Bernstein L., Lobo R. A., Shimizu H., Stanczyk F. Z., Pike M. C., Henderson B. E. 5{alpha}-reductase activity and risk of prostate cancer among Japanese and U.S. white and black males. Lancet, 339: 887-889, 1992.[Medline]
  7. Lookingbill D. P., Demers L. M., Wang C., Leung A., Rittmaster R. S., Santen R. J. Clinical and biological parameters of androgen action in normal healthy Caucasian versus Chinese subjects. J. Clin. Endocrinol. Metab., 72: 1242-1248, 1991.[Abstract]
  8. Feigelson H. S., Coetzee G. A., Kolonel L. N., Ross R. K., Henderson B. E. A polymorphism in the CYP17 gene increases the risk of breast cancer. Cancer Res., 57: 1063-1065, 1997.[Abstract/Free Full Text]
  9. Lunn R. M., Bell D. A., Mohler J. L., Taylor J. A. Prostate cancer risk and polymorphism in 17 hydroxylase (CYP17) and steroid reductase (SRD5A2). Carcinogenesis (Lond.), 20: 1727-1731, 1999.[Abstract/Free Full Text]
  10. Gsur A., Bernhofer G., Hinteregger S., Haidinger G., Schatzl G., Madersbacher S., Marberger M., Vutuc C., Mickshe M. A polymorphism in the CYP17 gene is associated with prostate cancer risk. Int. J. Cancer, 87: 434-437, 2000.[Medline]
  11. Wadelius M., Andersson A. O., Johansson J. E., Wadelius C., Rane E. Prostate cancer associated with CYP17 genotype. Pharmacogenetics, 9: 635-639, 1999.[Medline]
  12. Carey A. H., Waterworth D., Patel K., White D., Little J., Novelli P., Franks S., Williamson R. Polycystic ovaries and premature male pattern baldness are associated with one allele of the steroid metabolism gene CYP17. Hum. Mol. Genet., 3: 1873-1876, 1994.[Abstract/Free Full Text]
  13. Feigelson H. S., Shames L. S., Pike M. C., Coetzee G. A., Stanczyk F. Z., Henderson B. E. Cytochrome P450c17{alpha} gene: polymorphism is associated with serum estrogen and progesterone concentrations. Cancer Res., 58: 585-587, 1998.[Abstract/Free Full Text]
  14. Haiman C. A., Hankinson S. E., Spiegelman D., Colditz G. A., Willett W. C., Speizer F. E., Kelsey K. T., Hunter D. J. The relationship between a polymorphism in CYP17 with plasma hormone levels and breast cancer. Cancer Res., 59: 1015-1020, 1999.[Abstract/Free Full Text]
  15. Weston A., Pan C-F., Bleiweiss I. J., Ksieski H. B., Roy N., Maloney N., Wolff M. S. CYP17 genotype and breast cancer risk. Cancer Epidemiol. Biomark. Prev., 7: 941-944, 1998.[Abstract]
  16. Dunning A. M., Healey C. S., Pharoah P. D. P., Foster N. A., Lipscombe J. M., Redman K. L., Easton D. F., Day N. E., Ponder B. A. J. No association between a polymorphism in the steroid metabolism gene CYP17 and risk of breast cancer. Br. J. Cancer, 77: 2045-2047, 1998.[Medline]
  17. Makridakis N., Ross R. K., Pike M. C., Chang L., Stanczyk F. Z., Kolonel L. N., Shi C-Y., Yu M. C., Henderson B. E., Reichardt J. K. V. A prevalent missense substitution that modulates activity of prostatic steroid 5{alpha}-reductase. Cancer Res., 57: 1020-1022, 1997.[Abstract/Free Full Text]
  18. Febbo P. G., Kantoff P. W., Platz E. A., Casey D., Batter S., Giovannucci E., Hennekens C. S., Stampfer J. M. The V89L polymorphism in the 5{alpha}-reductase type 2 gene and risk of prostate cancer. Cancer Res., 59: 5878-5881, 1999.[Abstract/Free Full Text]
  19. Allen N. E., Appleby P. N., Davey G. K., Key T. J. Hormones and diet: low insulin-like growth factor-I but normal bioavailable androgens in vegan men. Br. J. Cancer, 83: 95-97, 2000.[Medline]
  20. Bartsch W. Interrelationships between sex hormone-binding globulin and testosterone, 5{alpha}-dihydrotestosterone and oestradiol-17ß in blood of normal men. Maturitas, 2: 109-118, 1980.[Medline]
  21. Södergaard R. R., Backstrom T., Shanbhag V., Carstensen H. Calculation of free and unbound fractions of testosterone and estradiol-17ß to human plasma proteins at body temperature. J. Steroid Biochem., 6: 801-810, 1982.
  22. StataCorp. Stata Statistical Software. Release 5.0. College Station, TX: Stata Corporation, 1997.
  23. Vermeulen A., Verdonck G. Representativeness of a single point plasma testosterone level for the long term hormonal milieu in men. J. Clin. Endocrinol. Metab., 74: 939-942, 1992.[Abstract]
  24. Nedelcheva Kristensen V. N., Haraldsen E. K., Anderson K. B., Lønning P. E., Erikstein B., Käresen R., Gabrielsen O. S., Børresen-Dale A-L. CYP17 and breast cancer risk: the polymorphism in the 5' flanking area of the gene does not influence binding to Sp-1. Cancer Res., 59: 2825-2828, 1999.[Abstract/Free Full Text]
  25. Makridakis N. M., Ross R. K., Pike M. C., Crocitto L. E., Kolonel L. N., Pearce C. L., Henderson B. E., Reichardt J. K. Association of missense substitution in SRD5A2 gene with prostate cancer in African-American and Hispanic men in Los Angeles, USA. Lancet, 354: 975-978, 1999.[Medline]
  26. Davis D. L., Russell D. W. Unusual length polymorphism in human steroid 5 {alpha}-reductase type 2 gene (SRD5A2). Hum. Mol. Genet., 2: 820 1993.[Free Full Text]
  27. Habib F. K., Ross M., Tate R., Chisholm G. D. Differential effect of finasteride on the tissue androgen concentrations in benign prostatic hyperplasia. Clin. Endocrinol., 46: 137-144, 1997.[Medline]
  28. Uygur M. C., Arik A. I., Altug U., Erol D. Effects of the 5{alpha}-reductase inhibitor finasteride on serum levels of gonadal, adrenal and hypophyseal hormones and its clinical significance: a prospective clinical study. Steroids, 63: 208-213, 1998.[Medline]
  29. Castro-Magana M., Angulo M., Fuentes B., Canas A., Sarrantonio M., Arguello R., Vitollo P. Effect of finasteride on human testicular steroidogenesis. J. Androl., 17: 516-521, 1996.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
I. Boger-Megiddo, N. S. Weiss, M. J. Barnett, G. E. Goodman, and C. Chen
V89L Polymorphism of the 5{alpha}-Reductase Type II Gene (SRD5A2), Endogenous Sex Hormones, and Prostate Cancer Risk
Cancer Epidemiol. Biomarkers Prev., February 1, 2008; 17(2): 286 - 291.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. Beesley, S. J. Jordan, A. B. Spurdle, H. Song, S. J. Ramus, S. K. Kjaer, E. Hogdall, R. A. DiCioccio, V. McGuire, A. S. Whittemore, et al.
Association Between Single-Nucleotide Polymorphisms in Hormone Metabolism and DNA Repair Genes and Epithelial Ovarian Cancer: Results from Two Australian Studies and an Additional Validation Set
Cancer Epidemiol. Biomarkers Prev., December 1, 2007; 16(12): 2557 - 2565.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. T. Campbell, L. Edwards, J. R. McLaughlin, J. Green, H. B. Younghusband, and M. O. Woods
Cytochrome P450 17A1 and Catechol O-Methyltransferase Polymorphisms and Age at Lynch Syndrome Colon Cancer Onset in Newfoundland
Clin. Cancer Res., July 1, 2007; 13(13): 3783 - 3788.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. O. Goodarzi, N. A. Shah, H. J. Antoine, M. Pall, X. Guo, and R. Azziz
Variants in the 5{alpha}-Reductase Type 1 and Type 2 Genes Are Associated with Polycystic Ovary Syndrome and the Severity of Hirsutism in Affected Women
J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 4085 - 4091.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. T. T. Thai, M. Kalbasi, K. Lagerstedt, L. Frisen, I. Kockum, and A. Nordenskjold
The Valine Allele of the V89L Polymorphism in the 5-{alpha}-Reductase Gene Confers a Reduced Risk for Hypospadias
J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6695 - 6698.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
N. C. Onland-Moret, C. H. van Gils, M. Roest, D. E. Grobbee, and P. H.M. Peeters
Cyp17, Urinary Sex Steroid Levels and Breast Cancer Risk in Postmenopausal Women
Cancer Epidemiol. Biomarkers Prev., April 1, 2005; 14(4): 815 - 820.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
H. L. Parnes, I. M. Thompson, and L. G. Ford
Prevention of Hormone-Related Cancers: Prostate Cancer
J. Clin. Oncol., January 10, 2005; 23(2): 368 - 377.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
L. Sharp, A. H. Cardy, S. C. Cotton, and J. Little
CYP17 Gene Polymorphisms: Prevalence and Associations with Hormone Levels and Related Factors. A HuGE Review
Am. J. Epidemiol., October 15, 2004; 160(8): 729 - 740.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. Ntais, A. Polycarpou, and J. P. A. Ioannidis
SRD5A2 Gene Polymorphisms and the Risk of Prostate Cancer: A Meta-Analysis
Cancer Epidemiol. Biomarkers Prev., July 1, 2003; 12(7): 618 - 624.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
N. E. Allen, J. K. V. Reichardt, H. Nguyen, and T. J. Key
Association between Two Polymorphisms in the SRD5A2 Gene and Serum Androgen Concentrations in British Men
Cancer Epidemiol. Biomarkers Prev., June 1, 2003; 12(6): 578 - 581.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. Ntais, A. Polycarpou, and J. P. A. Ioannidis
Association of the CYP17 Gene Polymorphism with the Risk of Prostate Cancer: A Meta-Analysis
Cancer Epidemiol. Biomarkers Prev., February 1, 2003; 12(2): 120 - 126.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
T. R. Rebbeck
Inherited Genotype and Prostate Cancer Outcomes
Cancer Epidemiol. Biomarkers Prev., October 1, 2002; 11(10): 945 - 952.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
A. Nyska, A. Dayan, and R. R. Maronpot
New Tools in Therapeutic Research--Prostatic Cancer and Models
Toxicol Pathol, February 1, 2002; 30(2): 283 - 287.
[PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
A. W. Hsing, C. Chen, A. P. Chokkalingam, Y.-T. Gao, D. A. Dightman, H. T. Nguyen, J. Deng, J. Cheng, I. A. Sesterhenn, F. K. Mostofi, et al.
Polymorphic Markers in the SRD5A2 Gene and Prostate Cancer Risk: A Population-based Case-control Study
Cancer Epidemiol. Biomarkers Prev., October 1, 2001; 10(10): 1077 - 1082.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. A. Haiman, M. J. Stampfer, E. Giovannucci, J. Ma, N. E. Decalo, P. W. Kantoff, and D. J. Hunter
The Relationship between a Polymorphism in CYP17 with Plasma Hormone Levels and Prostate Cancer
Cancer Epidemiol. Biomarkers Prev., July 1, 2001; 10(7): 743 - 748.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Allen, N. E.
Right arrow Articles by Key, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Allen, N. E.
Right arrow Articles by Key, T. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online