
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Clinical Sciences, National Cancer Institute, NIH, Bethesda, Maryland 20892 [D. R., J. A. T., P. R. T.]; Yunnan Tin Corporation, Gejiu, Yunnan Province, Peoples Republic of China [S-X. Y.]; New Chemical Entities, Inc., Thetagen Division, Bothell, Washington 98011 [M. R. A.]; Cancer Institute, Chinese Academy of Medical Sciences, Beijing, Peoples Republic of China [Y-L. Q.]; Information Management Services, Inc., Silver Spring, Maryland 20904 [M. J. B., C. A. G.]; Department of Pathology, Johns Hopkins School of Medicine, Baltimore, Maryland 21205 [Y. E.]; H. Lee Moffit Cancer Center and Research Institute, Tampa, Florida 33612 [M. S. T.]
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The subjects in this study are miners for the YTC in China. The
incidence rates of lung cancer are extraordinarily high in this
population. Males >40 years of age with underground mining experience
have a crude annual incidence of >1%. Miners 6064 years of age have
an incidence rate in excess of 2.5% annually. Lung cancer represents
80% of all cancers seen annually among YTC employees, and mortality
from this cancer is 10-fold higher in this area than the rest of China
(14)
. For males >50 years of age, the lung cancer
incidence rate is 37-fold higher than SEER rates for US males
(15)
. This population has been exposed to a number of
known carcinogens, including tobacco smoke, radon, and arsenic
(16)
. The goal of the current study is to both explore the
association between the XRCC1 polymorphisms (individually
and in combination) and the risk of lung cancer and to assess whether
selected environmental exposures might serve to modify the risk of lung
cancer associated with these polymorphisms.
| Materials and Methods |
|---|
|
|
|---|
40 years of age with
10 years of underground
mining and/or smelting experience and who were free of cancer (except
for non-melanoma skin cancer) at baseline in 1992. The baseline and
follow-up activities were added to an annual YTC screening of the
miners ongoing since 1973. These activities included an interview about
demographic, dietary, residential, occupational, and medical histories;
a 24-h food recall; chest X-ray, physical exam; and sputum collection.
The initial cohort established in 1992 had 6259 miners, and with each
annual screen more miners entered the cohort as they reached the
eligibility criteria, resulting in 9143 cohort members by 1997. During
the annual screenings in 1993 and 1994, all miners were asked to
provide a fasting blood specimen. Because of cultural taboos, only
50% of 9143 participants provided blood. The sub-cohort that
provided blood specimens was representative of the larger high-risk
cohort. Lung cancer cases were ascertained by reports to the Cancer
Registry of the Labor Protection Institute of the YTC or from the
annual screens and were confirmed by the Joint National Cancer
Institute/YTC Diagnosis Review Committee. Lung cancer cases were
diagnosed by X-ray, sputum cytology, endoscopy, biopsy, and
thoracotomy. Detailed descriptions of risk factors, criteria for lung
cancer diagnoses, and histology of tumors have been published
previously (14)
. More than 80% of the cases identified
were classified as squamous cell carcinoma of the lung.
Selection of Cases and Controls.
The cases consisted of 106 men and 2 women, 4074 years of age,
diagnosed with primary lung cancer during the years 19921997 among
the sub-cohort of those who had given blood. Using incidence density
sampling, we randomly selected controls from cohort participants who
were alive and free of cancer at the time the matched cases were
diagnosed. Controls were matched to cases on age (±2 years) and sex in
a 2:1 ratio. Selection of cases and controls was independent of the
assessment of XRCC1 genotype.
Definition of Exposures.
All variables used in this study were derived from baseline
evaluations. The cumulative radon exposure estimate for each subject
was obtained by summing across the estimated working level months for
each job held at the YTC prior to the date of entry at initial
screening for the high-risk cohort. The cumulative individual arsenic
exposure for each subject was estimated using an index for arsenic
exposure (Index of Arsenic Exposure Months), which was calculated as a
time weighted average of arsenic concentration (mg/m3)
times exposure months (mg/m3 x months). Arsenic
concentration (mg/m3) was assessed in different work areas
by measuring airborne arsenic dust levels. Individuals who had smoked
cigarettes and/or pipes (water pipes or Chinese long-stem pipes)
regularly for 6 months or longer at any time in their life were
classified as ever smokers and were asked for information on a variety
of smoking-related issues. Pack-year equivalents (g tobacco/day x
years ÷ 20) were used to measure cumulative tobacco consumption,
which was calculated separately for cigarettes (1 cigarette =
1 g), water pipe, long-stem pipe, and total tobacco use
(17)
. The tobacco exposure variables used in the current
study were derived from the total tobacco (g/day) use variable and from
years of smoking all tobacco products. Alcohol intake information,
including alcohol from grain liquor, wine, and other spirits, was
obtained by a single 24-h food and beverage recall questionnaire.
Polymorphism Analyses.
All polymorphisms were analyzed using genomic DNA from lymphocytes
using the ABI Prism 7700 sequence detector (TaqMan; PE
Biosystems, Foster City, CA). PCR primers and dual-labeled allele
discrimination probes were designed using PrimerExpress, version 1.0
(PE Biosystems). Probes were selected that had a predicted
Tm near 68°C, with the polymorphic base near
the center. Flanking PCR primers were selected based on the calculated
penalty score, Tm, length, and amplimer size.
For the C-to-T polymorphism in exon 6, codon 194 "turbo" probes
(with T = 5-propyne-2'-deoxyuridine) were used. Oligonucleotide
sequences for the analyses were as follows:
Exon 6 codon 194:
Forward primer: GAGGATGAGAGCGCCAACTCT
Reverse primer: ACGTTGTCCGAGCTCACCTG
T allele probe: CTCTTCTTCAGCTGGATCAACAAGA
C allele probe: TCTTCTTCAGCCGGATCAACAAG
Exon 9, codon 280:
Forward primer: GACCCCCAGTGGTGCTAACC
Reverse primer: GCCTTCTCCTCGGGGTTTG
A allele probe: AGCTCCAACTCATACCCCAGCCACA
G allele probe: AGCTCCAACTCGTACCCCAGCCAC
Exon 10, codon 399:
Forward primer: GTAAGGAGTGGGTGCTGGACTGT
Reverse primer: GTCTGACTCCCCTCCAGATTCC
A allele probe: CTGCCCTCCCAGAGGTAAGGCCTC
G allele probe: CTGCCCTCCCGGAGGTAAGGCC
Genotyping reactions (10 µl) contained
20 ng of genomic DNA,
1x TaqMan Master Mix, dual-labeled probes (100 nM each),
and PCR primers (900 nM each). Reactions were performed in
96-well MicroAmp Optical reaction plates and caps (PE Biosystems).
Plates were incubated at 50°C for 2 min and 95°C for 10 min,
followed by 40 cycles of 95°C for 15 s and 62°C for 1 min. An
annealing temperature of 64°C was used for the exon 6 assay. Reaction
data were analyzed with Sequence Detection System, version 1.6.3.
Amplified DNA from several individuals exhibiting each genotype was
electrophoresed on an agarose gel to confirm amplimer size and
sequenced to confirm each genotype. All lab personnel were blind to the
case-control status of the samples. For quality control, genotype
determinations were repeated for a random sample of 10% of study
participants, and we observed a 100% concordance rate.
Statistical Analyses.
The Wilcoxon rank-sum test was used to test the hypothesis that the
distribution of baseline characteristics was the same for cases and
controls. The
2
test for heterogeneity was used for
categorical variables to test the hypothesis that the distribution of
allele prevalences was the same for cases and controls. Conditional
logistic regression techniques were used to examine the association
between genotype and lung cancer. Modification of the effect of
genotype on lung cancer risk by age, radon exposure, arsenic exposure,
and alcohol and tobacco consumption was examined by statistical tests
of the first order interaction term in the logistic regression models.
Statistical analyses stratified by environmental exposure were
conducted by breaking the case-control match to avoid the loss of
subjects due to splitting of matched sets that fell into different
strata and using unconditional logistic regression adjusted for age and
sex (the original matching criteria) and other potential confounders.
Potential confounding of the association between genotype and cancer risk by other related risk factors was explored using Spearman rank correlation analysis and multivariate logistic regression models, including stepwise regression models both before and after stratification. If the potential confounder caused a significant change in the log likelihood estimate (P < 0.05) and a >20% change in the ß coefficient, it was kept in the model for further multivariate analysis.
Among cases and controls in our study, 48% were alcohol drinkers (50% cases and 48% controls), and almost all alcohol consumed was in the form of grain liquor. To avoid potential misclassification of the amount of alcohol consumed, we restricted our analysis to alcohol drinker status. Our alcohol data is based on 24-h recall questionnaire, which gives a better estimate of drinker status than actual consumption. Exclusion of early cases (diagnosed within 1 year of blood draw) did not materially alter any of the risk estimates. All analyses were performed using the statistical software package STATA (STATA Corporation, College Station, TX).
| Results |
|---|
|
|
|---|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Lack of XRCC1 activity in mice is an embryo-lethal condition. Thus, it can be assumed that the three human XRCC1 polymorphisms do not cause complete loss of protein function. There currently are no reports on the association between XRCC1 polymorphisms and lung cancer risk. The Arg194Trp and Arg280His amino acid substitutions reside in the linker region separating the DNA polymerase ß domain from the poly(ADP-ribose) polymerase-interacting domain. The Arg399Gln change occurs in the COOH-terminal side of the poly(ADP-ribose) polymerase-interacting domain and within an identified BRCT domain (9) . Amino acid substitutions in the BRCT domain and in the DNA polymerase ßinteracting domain in the hamster have been reported to disrupt the functionality of XRCC1 (19) .
Our findings suggest that the XRCC1 Arg280His polymorphism is associated with the risk of lung cancer. Individuals with the variant allele were at 80% greater risk compared with those with the homozygous wild-type genotype after adjustment for radon and tobacco exposure. In addition, although the numbers were small in our population, all three individuals with the homozygous variant genotype developed lung cancer. Haplotype analyses also confirmed this finding, where individuals with the Arg280His variant alone were at almost 3-fold (P = 0.07) greater risk of lung cancer compared with individuals who were wild-type for all three XRCC1 polymorphisms. The polymorphisms at codons 194 and 399 were not associated with lung cancer risk in our study. In fact, individuals with the Arg194Trp substitution allele seemed to be at reduced risk of lung cancer, although the risk estimates were not statistically significant (OR, 0.7; 95% CI, 0.431.16). This finding is consistent with that reported by Sturgis et al. (20) , where the Arg194Trp polymorphism was associated with a reduction in risk of squamous cell carcinoma of the pharynx and oral cavity, another cancer related to tobacco and alcohol consumption.
XRCC1 may be involved in base excision repair of genomic damage attributable to environmental exposure to carcinogens such as tobacco or alcohol. We observed a statistically significant interaction between cumulative tobacco exposure and the Arg194Trp polymorphism (P = 0.05). However, this interaction was apparently driven by an association between the Arg194Trp polymorphism and smoking (P = 0.015) among the controls and failed to meet the test of independence of genotype and environmental exposure among the controls.
Alcohol drinking apparently modified the effect of the Arg194Trp and the Arg280His polymorphisms on lung cancer risk. Among alcohol drinkers, the Arg194Trp variant allele reduced the risk of lung cancer compared with individuals with the homozygous wild-type genotype. The Arg194Trp variant may be able to enhance DNA repair activity, leading to reduced risk of lung cancer compared with those with the homozygous wild-type genotype. Conversely, among alcohol drinkers the Arg280His polymorphism increased the risk of lung cancer compared with those with the homozygous wild-type genotype. Apparently, unlike the Arg194Trp polymorphism, the Arg280His polymorphism may result in lower DNA repair ability compared with homozygous wild type. However, because of the small sample size of our study group, these observation need to be interpreted with caution. A plausible explanation for our observations of "alcohol interactions" with XRCC1 Arg194Trp and Arg280His polymorphisms may be just chance.
One of the strengths of this study is its prospective design. The collection of covariate data (e.g., smoking and alcohol) before case diagnosis minimized the potential for recall bias for measures of environmental exposures, and the availability of these data also allowed us to explore gene-environment interactions. One of the limitations of our study, as mentioned earlier, was its rather small sample size. The generalizability of these results may also be somewhat restricted because the study was conducted among a rather unique group of tin miners. Other studies examining the effects of XRCC1 and other DNA repair polymorphisms and lung cancer risk are clearly needed.
In summary, this is the first observational study to examine the association between the three polymorphisms of XRCC1 and risk of lung cancer. Our data suggest a modest elevated risk for lung cancer in individuals with the Arg280His XRCC1 polymorphism.
| Footnotes |
|---|
1 To whom requests for reprints should be
addressed, at Cancer Prevention Studies Branch, DCS, NCI, 6006
Executive Boulevard, Suite 321, Bethesda, MD 20892-7058. Phone: (301)
594-2936; Fax: (301) 435-8645; E-mail: DR132K{at}NIH.gov ![]()
2 The abbreviations used are: XRCC1, X-ray repair
cross-complementing group 1; YTC, Yunnan Tin Corporation: OR, odds
ratio; CI, confidence interval. ![]()
Received 5/10/00; revised 12/ 1/00; accepted 12/11/00.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y.-G. Fan, P. Hu, Y. Jiang, R.-S. Chang, S.-X. Yao, W. Wang, J. He, P. Prorok, and Y.-L. Qiao Association Between Sputum Atypia and Lung Cancer Risk in an Occupational Cohort in Yunnan, China Chest, March 1, 2009; 135(3): 778 - 785. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mahabir, C. C Abnet, Y.-L. Qiao, L. D Ratnasinghe, S. M Dawsey, Z.-W. Dong, P. R Taylor, and S. D Mark A prospective study of polymorphisms of DNA repair genes XRCC1, XPD23 and APE/ref-1 and risk of stroke in Linxian, China J Epidemiol Community Health, August 1, 2007; 61(8): 737 - 741. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Hung, J. Hall, P. Brennan, and P. Boffetta Genetic Polymorphisms in the Base Excision Repair Pathway and Cancer Risk: A HuGE Review Am. J. Epidemiol., November 15, 2005; 162(10): 925 - 942. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, J. Wan, X. Jin, T. Jin, H. Shen, D. Lu, and Z. Xia Genetic Polymorphisms in XRCC1, APE1, ADPRT, XRCC2, and XRCC3 and Risk of Chronic Benzene Poisoning in a Chinese Occupational Population Cancer Epidemiol. Biomarkers Prev., November 1, 2005; 14(11): 2614 - 2619. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Majumder, N. Sikdar, R. R. Paul, and B. Roy Increased Risk of Oral Leukoplakia and Cancer Among Mixed Tobacco Users Carrying XRCC1 Variant Haplotypes and Cancer Among Smokers Carrying Two Risk Genotypes: One on Each of Two Loci, GSTM3 and XRCC1 (Codon 280) Cancer Epidemiol. Biomarkers Prev., September 1, 2005; 14(9): 2106 - 2112. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Casson, Z. Zheng, S. C. Evans, P. J. Veugelers, G. A. Porter, and D. L. Guernsey Polymorphisms in DNA repair genes in the molecular pathogenesis of esophageal (Barrett) adenocarcinoma Carcinogenesis, September 1, 2005; 26(9): 1536 - 1541. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Hu, H. Ma, F. Chen, Q. Wei, and H. Shen XRCC1 Polymorphisms and Cancer Risk: A Meta-analysis of 38 Case-Control Studies Cancer Epidemiol. Biomarkers Prev., July 1, 2005; 14(7): 1810 - 1818. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Matullo, M. Berwick, and P. Vineis Gene-Environment Interactions: How Many False Positives? J Natl Cancer Inst, April 20, 2005; 97(8): 550 - 551. [Full Text] [PDF] |
||||
![]() |
R. J. Hung, P. Brennan, F. Canzian, N. Szeszenia-Dabrowska, D. Zaridze, J. Lissowska, P. Rudnai, E. Fabianova, D. Mates, L. Foretova, et al. Large-Scale Investigation of Base Excision Repair Genetic Polymorphisms and Lung Cancer Risk in a Multicenter Study J Natl Cancer Inst, April 20, 2005; 97(8): 567 - 576. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shen, M. D. Gammon, M. B. Terry, L. Wang, Q. Wang, F. Zhang, S. L. Teitelbaum, S. M. Eng, S. K. Sagiv, M. M. Gaudet, et al. Polymorphisms in XRCC1 Modify the Association between Polycyclic Aromatic Hydrocarbon-DNA Adducts, Cigarette Smoking, Dietary Antioxidants, and Breast Cancer Risk Cancer Epidemiol. Biomarkers Prev., February 1, 2005; 14(2): 336 - 342. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamamoto, H. Hanafusa, M. Ouchida, M. Yano, H. Suzuki, M. Murakami, M. Aoe, N. Shimizu, K. Nakachi, and K. Shimizu Single nucleotide polymorphisms in the EXO1 gene and risk of colorectal cancer in a Japanese population Carcinogenesis, February 1, 2005; 26(2): 411 - 416. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ito, K. Matsuo, N. Hamajima, T. Mitsudomi, T. Sugiura, T. Saito, T. Yasue, K.-M. Lee, D. Kang, K.-Y. Yoo, et al. Gene-environment interactions between the smoking habit and polymorphisms in the DNA repair genes, APE1 Asp148Glu and XRCC1 Arg399Gln, in Japanese lung cancer risk Carcinogenesis, August 1, 2004; 25(8): 1395 - 1401. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Savas, D. Y. Kim, M. F. Ahmad, M. Shariff, and H. Ozcelik Identifying Functional Genetic Variants in DNA Repair Pathway Using Protein Conservation Analysis Cancer Epidemiol. Biomarkers Prev., May 1, 2004; 13(5): 801 - 807. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Figueiredo, J. A. Knight, L. Briollais, I. L. Andrulis, and H. Ozcelik Polymorphisms XRCC1-R399Q and XRCC3-T241M and the Risk of Breast Cancer at the Ontario Site of the Breast Cancer Family Registry Cancer Epidemiol. Biomarkers Prev., April 1, 2004; 13(4): 583 - 591. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-M. Gao, M. Romkes, J. M. Siegfried, J. D. Luketich, and P. Keohavong No Association between the XPD 312, 751, or XRCC1 399 Polymorphisms and K-ras Gene Mutation in Smoking Non-Small-Cell Lung Cancer Cancer Epidemiol. Biomarkers Prev., April 1, 2004; 13(4): 673 - 675. [Full Text] [PDF] |
||||
![]() |
Y. Zhu, M. R. Spitz, C. I. Amos, J. Lin, M. B. Schabath, and X. Wu An Evolutionary Perspective on Single-Nucleotide Polymorphism Screening in Molecular Cancer Epidemiology Cancer Res., March 15, 2004; 64(6): 2251 - 2257. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Hagmar, U. Stromberg, S. Bonassi, I.-L. Hansteen, L. E. Knudsen, C. Lindholm, and H. Norppa Impact of Types of Lymphocyte Chromosomal Aberrations on Human Cancer Risk: Results from Nordic and Italian Cohorts Cancer Res., March 15, 2004; 64(6): 2258 - 2263. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Rybicki, D. V. Conti, A. Moreira, M. Cicek, G. Casey, and J. S. Witte DNA Repair Gene XRCC1 and XPD Polymorphisms and Risk of Prostate Cancer Cancer Epidemiol. Biomarkers Prev., January 1, 2004; 13(1): 23 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-O. Shu, Q. Cai, Y.-T. Gao, W. Wen, F. Jin, and W. Zheng A Population-Based Case-Control Study of the Arg399Gln Polymorphism in DNA Repair Gene XRCC1 and Risk of Breast Cancer Cancer Epidemiol. Biomarkers Prev., December 1, 2003; 12(12): 1462 - 1467. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Moullan, D. G. Cox, S. Angele, P. Romestaing, J.-P. Gerard, and J. Hall Polymorphisms in the DNA Repair Gene XRCC1, Breast Cancer Risk, and Response to Radiotherapy Cancer Epidemiol. Biomarkers Prev., November 1, 2003; 12(11): 1168 - 1174. [Abstract] [Full Text] |
||||
![]() |
E.-Y. Cho, A. Hildesheim, C.-J. Chen, M.-M. Hsu, I-H. Chen, B. F. Mittl, P. H. Levine, M.-Y. Liu, J.-Y. Chen, L. A. Brinton, et al. Nasopharyngeal Carcinoma and Genetic Polymorphisms of DNA Repair Enzymes XRCC1 and hOGG1 Cancer Epidemiol. Biomarkers Prev., October 1, 2003; 12(10): 1100 - 1104. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-M. Gao, M. Romkes, R. D. Day, J. M. Siegfried, J. D. Luketich, H. H. Mady, M. F. Melhem, and P. Keohavong Association of the DNA repair gene XPD Asp312Asn polymorphism with p53 gene mutations in tobacco-related non-small cell lung cancer Carcinogenesis, October 1, 2003; 24(10): 1671 - 1676. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhou, G. Liu, D. P. Miller, S. W. Thurston, L. L. Xu, J. C. Wain, T. J. Lynch, L. Su, and D. C. Christiani Polymorphisms in the DNA Repair Genes XRCC1 and ERCC2, Smoking, and Lung Cancer Risk Cancer Epidemiol. Biomarkers Prev., April 1, 2003; 12(4): 359 - 365. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Goode, C. M. Ulrich, and J. D. Potter Polymorphisms in DNA Repair Genes and Associations with Cancer Risk Cancer Epidemiol. Biomarkers Prev., December 1, 2002; 11(12): 1513 - 1530. [Abstract] [Full Text] [PDF] |
||||
![]() |
G E Goodman Lung cancer * 1: Prevention of lung cancer Thorax, November 1, 2002; 57(11): 994 - 999. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Shields Tobacco Smoking, Harm Reduction, and Biomarkers J Natl Cancer Inst, October 2, 2002; 94(19): 1435 - 1444. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Vogel, P. Moller, L. Dragsted, S. Loft, A. Pedersen, and B. Sandstrom Inter-individual variation, seasonal variation and close correlation of OGG1 and ERCC1 mRNA levels in full blood from healthy volunteers Carcinogenesis, September 1, 2002; 23(9): 1505 - 1509. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tuimala, G. Szekely, S. Gundy, A. Hirvonen, and H. Norppa Genetic polymorphisms of DNA repair and xenobiotic-metabolizing enzymes: role in mutagen sensitivity Carcinogenesis, June 1, 2002; 23(6): 1003 - 1008. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Taylor, A. Thistlethwaite, and K. W. Caldecott Central Role for the XRCC1 BRCT I Domain in Mammalian DNA Single-Strand Break Repair Mol. Cell. Biol., April 15, 2002; 22(8): 2556 - 2563. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Nelson, K. T. Kelsey, L. A. Mott, and M. R. Karagas The XRCC1 Arg399Gln Polymorphism, Sunburn, and Non-melanoma Skin Cancer: Evidence of Gene-Environment Interaction Cancer Res., January 1, 2002; 62(1): 152 - 155. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Albert, D. Ratnasinghe, J. Tangrea, and S. Wacholder Limitations of the Case-only Design for Identifying Gene-Environment Interactions Am. J. Epidemiol., October 15, 2001; 154(8): 687 - 693. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |