CEBP Frontiers in Cancer Prevention Research - 2008 Cancer Health Disparities Conference 2009
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hsing, A. W.
Right arrow Articles by Reichardt, J. K. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hsing, A. W.
Right arrow Articles by Reichardt, J. K. V.
Cancer Epidemiology Biomarkers & Prevention Vol. 10, 1077-1082, October 2001
© 2001 American Association for Cancer Research

Polymorphic Markers in the SRD5A2 Gene and Prostate Cancer Risk

A Population-based Case-control Study1

Ann W. Hsing2, Chu Chen, Anand P. Chokkalingam, Yu-Tang Gao, Douglas A. Dightman, Hanh T. Nguyen, Jie Deng, Jiarong Cheng, Isabell A. Sesterhenn, F. Kash Mostofi, Frank Z. Stanczyk and Juergen K. V. Reichardt

Division of Cancer Epidemiology and Genetics, National Cancer Institute, Bethesda, Maryland 20852-7234 [A. W. H., A. P. C.]; Fred Hutchinson Cancer Research Center, Seattle, Washington 98109 [C. C., D. A. D.]; Shanghai Cancer Institute, Shanghai, China 200032 [Y-T. G., J. D., J. C.]; Institute for Genetic Medicine, Department of Biochemistry and Molecular Biology, Keck School of Medicine, University of Southern California, Los Angeles, California 90089 [H. T. N., J. K. V. R.]; Armed Forces Institute of Pathology, Washington, D.C. 20306 [I. A. S., F. K. M.]; and Department of Obstetrics and Gynecology and Preventive Medicine, School of Medicine, University of Southern California, California 90033 [F. Z. S.]


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It has been suggested that the activity of the steroid 5{alpha}-reductase type II enzyme (encoded by the SRD5A2 gene) may be associated with prostate cancer risk and that population differences in this enzyme’s activity may account for part of the substantial racial/ethnic disparity in prostate cancer risk. To provide etiological clues, we evaluated the relationships of four polymorphic markers in the SRD5A2 gene, specifically, A49T (a substitution of threonine for alanine at codon 49), V89L (a substitution of leucine for valine at codon 89), R227Q (a substitution of glutamine for arginine at codon 227), and a (TA)n dinucleotide repeat, with prostate cancer risk in a population-based case-control study in China, a population with the lowest reported prostate cancer incidence rate in the world. Genotypes of these four markers were determined from genomic DNA of 191 incident cases of prostate cancer and 304 healthy controls using PCR-based assays, and serum androgen levels were measured in relation to these genotypes. All study subjects had the wild-type AA genotype of the A49T marker, and 99% had the RR genotype of the R227Q marker. For the V89L marker, prevalences of the LL, VV, and VL genotypes among controls were 35%, 21%, and 45%, respectively. Compared with men with the VV genotype, those with the LL genotype had a statistically nonsignificant 12% reduced risk (odds ratio = 0.88, 95% confidence interval, 0.53–1.47). In addition, men with the LL genotype had significantly higher serum levels of testosterone and significantly lower serum levels of 5{alpha}-androstane-3{alpha},17ß-diol glucuronide than men with other genotypes. Men heterozygous for the (TA)0 allele of the (TA)n marker had a modest, statistically nonsignificant risk reduction (odds ratio = 0.67; 95% confidence interval, 0.39–1.12) compared with men homozygous for the (TA)0 allele, along with significantly higher serum dihydrotestosterone levels. The observed V89L genotype prevalences and the association between V89L genotypes and serum androgen levels support the hypothesis that genotypes associated with lower levels of 5{alpha}-reductase activity are more common in low-risk populations. Although we found no statistically significant associations of these SRD5A2 polymorphisms with prostate cancer risk, a small effect of these markers cannot be ruled out because of the rarity of certain marker genotypes. Larger studies are needed to further clarify the role of these markers and to elucidate whether genetic diversity of the SRD5A2 gene, alone or in combination with other susceptibility genes, can help explain the large racial/ethnic differences in prostate cancer risk.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Prostate cancer is the most commonly diagnosed non-skin cancer and is the second leading cause of cancer death in men in the United States (1) . Despite the fact that the prevalence of latent prostate tumors appears to be similar in most populations (2) , there is a marked difference in the incidence of clinical prostate cancer, with African Americans having incidence rates that are 30–50 times higher than those of Asians living in Asia (3) . The reasons for the racial/ethnic differences in incidence are unclear.

There is compelling evidence supporting a role of androgens in prostate carcinogenesis (4) . Androgens are required for prostate growth, and administration of T3 in laboratory rats can induce prostate tumors (5 , 6) . Within the prostate gland, the type II steroid 5{alpha}-reductase enzyme irreversibly metabolizes T to DHT, which in turn binds to the androgen receptor, thus activating transcription of androgen receptor-responsive elements in target genes and inducing cellular proliferation (7) . The type II steroid 5{alpha}-reductase enzyme is encoded by the SRD5A2 gene located on chromosome 2 (2p23; Ref. 8 ). The SRD5A2 gene spans over 40 kb of genomic DNA, with 5 exons and 4 introns (9 , 10) . Although the enzyme has never been purified, over 22 mutations, including 10 single amino acid missense substitutions, have been reported for the SRD5A2 gene (11) .

It has been suggested that differences in steroid 5{alpha}-reductase type II enzyme activity may help explain part of the marked racial disparity in the incidence of clinical prostate cancer across populations (12) . Indirect data supporting this hypothesis include the observations that, compared with Western men, Asian men have lower circulating levels of T and much less body hair [a phenotype that is probably related to the activity of the type I enzyme (13 , 14) ] and that racial variation in the allele frequencies of several SRD5A2 markers associated with prostate cancer risk, including V89L (a valine to leucine substitution at codon 89) and (TA)n (a TA dinucleotide repeat in the 3'-UTR of the gene), parallels the patterns of prostate cancer risk in high- and low-risk populations (15, 16, 17) . For example, data from one genetic survey show that Asian men have a higher prevalence of the LL genotype of the V89L marker, which among Asians has been associated with lower serum levels of 3{alpha}-diol G, an indirect measure of intraprostatic 5{alpha}-reductase activity (15) .

Two studies reported a positive association with the A49T marker (an alanine to threonine substitution at codon 49) in Latinos and African Americans (16 , 18) . However, other studies in Western and Japanese men failed to show a significant association of the V89L polymorphism with prostate cancer risk (19, 20, 21) , and the (TA)n marker was not significantly associated with risk among Western men (20 , 22) . To provide insights into the reasons for the racial/ethnic disparity in prostate cancer risk, in this report we evaluate the roles of the V89L, A49T, (TA)n repeat, and R227Q (the arginine to glutamine substitution at codon 227) markers in prostate cancer in a multidisciplinary population-based case-control study in China. Serum androgen concentrations were also measured in relation to genotypes of the four polymorphisms. The first three markers were chosen because they have been implicated in prostate cancer etiology in previous studies (12) . We investigated the R227Q polymorphism because the RQ variant has significantly reduced 5{alpha}-reductase activity and to date has been observed only among Asians (11) .


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Study Subjects.
Details of the study have been described previously (23, 24, 25) . Briefly, cases of primary prostate cancer (International Classification of Diseases 9 code 185) newly diagnosed between 1993 and 1995 were identified through a rapid reporting system established between the Shanghai Cancer Institute and 28 collaborating hospitals in urban Shanghai. Cases were permanent residents in 10 urban districts of Shanghai (henceforth referred to collectively as Shanghai) who had no history of any other cancer. Because prostate cancer screening is not widespread in China, most cases are men with clinically significant cancers who present with symptoms. Case ascertainment is estimated to be essentially complete because reporting to the Shanghai Cancer Registry by all Shanghai hospitals is mandatory.

Based on the personal registry cards of all adults over age 18 years residing in urban Shanghai (maintained at the Shanghai Resident Registry), male population controls were selected randomly from the 6.5 million permanent residents of Shanghai and frequency-matched to the expected age distribution (by 5-year category) of prostate cancer cases.

Information on potential risk factors was elicited through an in-person interview by trained interviewers using a structured questionnaire. The interview included information on demographic characteristics, dietary and smoking history, consumption of alcohol and other beverages, medical history, family history of cancer, physical activity, body size, and sexual behavior. Of the 268 eligible cases (95% of the cases diagnosed in Shanghai during the study period), 243 (91%) were interviewed. After a consensus review by both the Chinese and American pathologists, four cases were classified as having benign prostatic hyperplasia and excluded from the study. Of the 495 eligible controls, 472 (95%) were interviewed. This study was approved by the Office of Human Subjects Research, NIH (Bethesda, MD) and the Institutional Review Board of the Shanghai Cancer Institute (Shanghai, China).

Blood Collection and DNA Extraction.
Two hundred cases (82% of those interviewed) and 330 controls (70%) provided 20 ml of fasting blood for the study. The blood samples were processed at a central laboratory in Shanghai. The buffy coat fractions were first stored at -70°C, and then shipped in dry ice to the American Type Culture Collection (Manassas, VA) for DNA extraction. Standard quality control procedures showed no evidence of contamination, and DNA purity and length were satisfactory. After DNA extraction, 191 cases and 305 controls had sufficient DNA for genotyping.

Genotyping.
To minimize bias due to day-to-day laboratory variation, DNA samples were arranged in case-control pairs and triplets such that the same proportion of total cases and controls was assayed in each batch. Laboratory personnel were masked to case-control status. Capillary electrophoresis and allele-specific PCR analyses were used to determine the (TA)n and V89L genotypes, whereas SSCP analyses were used to determine the A49T and R227Q markers (11 , 15, 16, 17 , 26) .

A49T.
Genotypes at the A49T polymorphism were determined as described previously (16) . Briefly, we amplified radiolabeled exon 1 of the SRD5A2 gene [using the primers oNM16 (GCAGCGGCCACCGGCG) and oNM32 (GTGGAAGTAATGTAGGCAGAA)] and then subjected it to SSCP analysis to determine genotypes at the A49T locus.

V89L.
The V89L polymorphism was analyzed using allele-specific PCR and the nonspecific forward primer (5'-AGGCAGCGCCACTTTGG-3'), the nonspecific reverse primer (5'-TCGGTGCGCGCTCCACG-3'), and either the valine-specific (5'-CTACCTGTGGAAGTAATGTAC-3') or the leucine-specific (5'-CTACCTGTGGAAGTAATGTAG-3') primer. Amplifications were performed in a PE Applied Biosystems GeneAmp PCR System 9700 as follows: initial denaturation at 95°C for 2 min; 15 cycles of 94°C for 1 min, 63°C for 1 min, and 72°C for 2 min; 25 cycles of 94°C for 1 min, 59°C for 1 min, and 72°C for 2 min; and a final extension at 72°C for 5 min. PCR products were resolved in a 3% Nusieve agarose gel, stained with ethidium bromide, visualized under UV light, and photographed. Allele calling was performed independently by two researchers.

R227Q.
The R227Q polymorphism was assayed as described previously (11) , using the primers oNM22 (h5a2-22; GCAATGATTGACCTTCCGATT) and oNM23 (GTTTGGAGAAGAAGAAAGCTAC) in PCR reactions followed by SSCP analysis.

TA Repeats.
The (TA)n marker was assayed using PCR reactions containing the reverse primer (5'-GGCAGAACGCCAGGAGAC-3'), as well as both unlabeled and TET-labeled forward primer (5'-GAAAACTGTCAAGCTGCTG-3'). Cycling conditions were as follows: 95°C for 2 min; 35 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 2 min; and 72°C for 5 min. Amplification was performed in a PE Applied Biosystems GeneAmp PCR System 9700, and the number of (TA) repeats was determined using a Perkin Elmer ABI Prism 310 genetic analyzer and clones with known numbers of repeats as standards.

Quality Control.
Twenty-four split samples from a single individual were spaced at intervals among the study samples to assess the reproducibility of genotyping. Of the 24 split samples genotyped for the V89L, R227Q, and (TA)n polymorphisms, all 24 were typed as VL, RR, and (TA)0, respectively. Of the 18 split samples assayed for A49T, 16 were typed as AA, whereas the other 2 had insufficient DNA.

Serum Hormone Analysis.
Serum concentrations of sex hormones, including T, DHT, estradiol, and 3{alpha}-diol G, and their binding protein, SHBG, were measured by RIA. Before RIA, T and DHT were extracted with hexane:ethyl acetate (3:2) and purified by Celite column partition chromatography as described previously (27 , 28) . Levels of 3{alpha}-diol G and SHBG were measured directly in serum using highly specific antisera (29 , 30) . The intra-assay and interassay coefficients of variation for all analytes ranged from 4–8% and 10–13%, respectively.

Statistical Analysis.
We compared frequencies of each of the marker genotypes by case control status. Unconditional logistic regression analyses were used to compute ORs and 95% CIs estimating the association of each of the SRD5A2 markers with prostate cancer risk after adjusting for other potential risk factors, including education, smoking, alcohol consumption, body mass index, waist:hip ratio, and physical activity (31) . We used overall F-tests from linear regression models to test for differences in mean age-adjusted serum sex hormone levels among controls across genotypes of each SRD5A2 marker. All presented Ps are two-sided.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Age at diagnosis ranged from 50–94 years (median age, 73 years) for cancer cases. About two-thirds of the cases were diagnosed as having advanced cancer (regional/remote stages), and most tumors were moderately or poorly differentiated. Most cases were symptomatic at diagnosis, with 77% of the cases having serum prostate-specific antigen levels greater than 10 ng/ml (median, 87 ng/ml). Compared with population controls, cases had significantly higher caloric intake, had significantly smaller hips and larger waist:hip ratios, and were somewhat less likely to be married, have had attended college, or be smokers or drinkers, although not significantly so (data not shown).

Table 1Citation shows the allele frequencies of each of the four markers by case-control status. We did not observe the T allele of the A49T marker among cases or controls, and for the R227Q marker, only three subjects (two cases and one control) possessed the Q allele. For the (TA)n repeat marker, the (TA)9 allele was less frequent among cases than controls (6.5% versus 9.1%), and the only subject carrying the (TA)18 allele was a control.


View this table:
[in this window]
[in a new window]
 
Table 1 Allele frequency of polymorphic markers in the SRD5A2 gene

 
Table 2Citation shows the distribution of genotypes for the four markers and age-adjusted ORs for prostate cancer in relation to these genotypes. Inclusion of any/all of the potential risk factors in regression models did not appreciably affect risk. Because all study subjects had the AA genotype for the A49T marker, no ORs could be estimated for this polymorphism. For the V89L marker, the heterozygous VL genotype was the most common (45%), followed by the homozygous LL genotype (35%) and the homozygous VV genotype (21%). Compared with men with the VV genotype, those with the LL genotype had a nonsignificant 12% reduced risk (OR, 0.88; 95% CI, 0.53–1.47). There was no association of the VL V89L genotype with risk. For the R227Q marker, compared with men with the RR genotype, those with the RQ genotype had a nonsignificantly elevated risk (OR, 2.85; 95% CI, 0.25–32.1), although this result is based on two cases and a single control subject.


View this table:
[in this window]
[in a new window]
 
Table 2 ORsa for prostate cancer in relation to polymorphic markers in the SRD5A2 gene

 
The (TA)0/(TA)0 genotype was the most common genotype of the (TA)n repeat polymorphism, and the heterozygous (TA)0/(TA)9 genotype was found to be less common among cases than controls (12% versus 17%). Because the (TA)18 allele was observed only once in this population [in a (TA)0/(TA)18 control], it was combined with the (TA)9 allele for logistic regression analysis. Men with the (TA)0/(TA)9 genotype had a modestly reduced risk compared with men homozygous for the (TA)0 allele (OR, 0.67; 95% CI, 0.39–1.12).

Age-adjusted mean serum levels of the sex hormones and SHBG by genotypes of V89L and (TA)n repeats are shown in Table 3Citation . Serum levels of T and 3{alpha}-diol G (but not DHT, estradiol, or SHBG) were significantly different across genotypes of the V89L polymorphism (P = 0.007 and P = 0.002, respectively). Men with the VL and LL genotypes had similar levels of both T and 3{alpha}-diol G. Compared with men with the VV genotype, men with the VL and LL genotypes had higher (17%) levels of T and lower (24%) levels of 3{alpha}-diol G. The (TA)0/(TA)9 genotype of the (TA)n repeat length polymorphism was significantly associated with a 14% higher serum DHT level compared with men with the (TA)0/(TA)0 genotype (P = 0.03). No association of the (TA)n polymorphism with serum T, 3{alpha}-diol G, estradiol, or SHBG levels was observed.


View this table:
[in this window]
[in a new window]
 
Table 3 Meansa and 95% CIs of serum hormone levels among population controls by genotypes of the V89L and (TA)n polymorphisms of the SRD5A2 gene

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We found no statistically significant associations with prostate cancer risk of the A49T, V89L, R227Q, and (TA)n polymorphisms in the SRD5A2 gene, although a modest effect of the (TA)n and V89L markers cannot be ruled out. The A49T T allele and the R227Q Q allele, which, along with the long (TA)n allele, have been linked to increased 5{alpha}-reductase enzyme activity in laboratory studies, were observed at very low frequencies, if at all. However, we found that men with the VV V89L genotype had significantly higher levels of 3{alpha}-diol G than men with other V89L genotypes, whereas men with the (TA)0/(TA)9 (TA)n genotype had higher DHT levels compared with men with the (TA)0/(TA)0 genotype, suggesting that these markers may potentially influence prostate cancer risk despite the nonsignificant risk estimates in our study. Consistent with earlier reports, our data show that the LL genotype of the V89L marker is common in Chinese men (35%), that (TA)0/(TA)0 is the most common genotype of the (TA)n marker, and that the R227Q marker’s rare RQ genotype, which is associated with reduced steroid 5{alpha}-reductase activity and has been detected only in Asians, is present in this Chinese population (16 , 17 , 19) .

Of the more than 20 mutations reported for the SRD5A2 gene, V89L is the most common (16) . Consistent with Febbo et al. (19) and Nam et al. (32) , we found a slight nonsignificant reduction in risk of prostate cancer associated with the LL genotype (12%), although two studies conducted among Western and Japanese men did not find such an association (20 , 21) . Reasons for this inconsistency are unclear, but they may be due in part to the use of benign prostatic hyperplasia patients as controls in one null study (21) . Recent studies show that distributions of V89L genotypes parallel the patterns of prostate cancer incidence in high- and low-risk populations, with LL genotype prevalences of 22–25% among Asians and of only about 4% among Caucasian and African Americans and VV genotype prevalences of 27–29% among Asians and of about 58% among African and Caucasian Americans (16 , 21) . Our data are consistent with these results: among controls, 35% had the LL genotype, and only 21% had the VV genotype. The prevalence among controls of the L allele was somewhat higher in this Chinese population than has been reported previously in a group of Chinese and Japanese men (57% versus 46%; Ref. 15 ). Although the risk reductions associated with the LL genotype in our study and in that of Febbo et al. (19) were nonsignificant, given the large racial differences in V89L genotype distributions and the marker’s potential influence on 5{alpha}-reductase enzyme activity, a small effect of the V89L polymorphism on prostate cancer risk cannot be ruled out. Larger studies are needed to elucidate whether the V89L polymorphism is associated with a modest elevation in prostate cancer risk.

Recent studies show that, compared with the VV genotype, the LL V89L genotype confers a 42% reduction in 5{alpha}-reductase enzymatic activity in vitro (11) . In addition, compared with the VV genotype, the LL genotype is associated with lower serum 3{alpha}-diol G levels among Asian (15) and British (33) men, although the difference was not significant among British men, possibly due to the low observed prevalence of the LL genotype (8%; Ref. 33 ). Similarly, in our study of Chinese men, the LL genotype is associated with significantly lower serum 3{alpha}-diol G levels compared with the VV genotype, suggesting lower 5{alpha}-reductase enzymatic activity among men with the LL genotype. The significantly higher serum T levels among men with the LL genotype (compared with men with the VV genotype) also suggests lower 5{alpha}-reductase activity, because within the prostate, lower 5{alpha}-reductase activity will result in less conversion of T to DHT, and the accumulating T within the prostate may leak back into circulation to raise serum levels. However, the lack of a complementary low serum DHT level among men with the LL genotype seems inconsistent with this possibility, which must thus be examined further. In addition, the dominant influence of the L allele on 5{alpha}-reductase enzyme activity suggested by the similar 3{alpha}-diol G levels among men with the VL and LL genotypes in our study, but not a previous one (33) , supports in vitro data showing that the L allele is partial dominant and that there is almost no difference in enzyme activity between the VL and LL genotypes (11) .

Despite the low frequency of the A49T T allele among healthy subjects in most populations, this allele is implicated in prostate cancer for several reasons: (a) an earlier study found almost 10% of the prostate cancer cases had the T allele (12) ; (b) the T allele was linked to progression and aggressiveness of prostate tumors in a pathologic survey (18) ; and (c) of all known mutations in the SRD5A2 gene, this substitution increased in vitro 5{alpha}-reductase enzymatic activity the most (almost 5-fold; Ref. 11 ). Earlier studies reported that only 0.5% of African Americans and 1.8% of Latino men harbored this allele (16 , 18) . In our study, we found no subjects with the T allele. Because of the rarity of the A49T T allele and its substantial impact on 5{alpha}-reductase activity, larger studies are needed to further clarify its role in the development of prostate cancer.

The Q allele of the R227Q polymorphism, like the T allele of the A49T marker, also substantially reduces 5{alpha}-reductase activity in vitro, and subjects with the RQ and QQ genotypes have reduced enzymatic activity compared with those with the RR genotype (11) . RR is the most common genotype in the healthy population; subjects with the QQ genotype are male pseudohermaphrodites (34) , and to date, the RQ genotype has been reported in Asians only (11) . In our study, we found no subjects with the QQ genotype. We are able to confirm that the Q allele was present in three heterozygotes (one control and two cases) but were unable to show a significant association with prostate cancer because of the rarity of the Q allele.

Because the (TA)n marker is located in the 3'-UTR of the SRD5A2 gene, its functional consequences are thought to be due to the instability of mRNA transcripts with UA-rich 3'-UTRs [transcribed from TA-rich regions of DNA (16 , 35) ], which may in turn affect 5{alpha}-reductase activity levels. The relevance of the (TA)n marker in prostate cancer is further supported by the finding that 56% of 30 prostate tumors possessed somatic mutations at this locus (36) . Three major (TA)n alleles have been reported, namely, (TA)0, (TA)9, and (TA)18, with (TA)0 being the most common in most populations. In our study, 84% of the controls had the (TA)0/(TA)0 genotype. Consistent with Kantoff et al. (22) , we found that men carrying copies of the longer (TA)n allele [all but one had the (TA)0/(TA)9 genotype] had a nonsignificantly lower risk of prostate cancer. We found that serum levels of DHT, but not those of other sex hormones, were higher among men with the (TA)0/(TA)9 genotype, although the biological significance of this is unclear. Finally, because only one subject in our study possessed the rare (TA)18 allele, we were unable to evaluate the effect of this long allele.

Rare, highly penetrant genetic factors that confer a high relative risk on the few individuals who carry them (for example, HPC1 on chromosome 1) may explain about 10% of the prostate cancer cases in the United States and are unlikely to explain the large racial/ethnic differences in prostate cancer risk. In contrast, common polymorphisms confer variable risk upon all individuals, which may, in turn, result in a much larger proportion of prostate cancer cases attributed to possession of certain genotypes. Although we found no statistically significant association with polymorphisms of SRD5A2, a small effect cannot be ruled out. Indeed, common polymorphisms of several susceptibility genes involved in androgen metabolism or signal transduction within the prostate have recently been linked to prostate cancer, including the AR, AIB1, CYP17, and HSD3B2 genes (12 , 24 , 37, 38, 39) .4 It is possible that a set of such markers might together alter androgenic action within the prostate gland, thus heightening prostate cancer risk in a subset of individuals. Future studies should examine the combined effects of these polymorphisms to provide insights into the origins of prostate cancer.

Biases arising from survival and selection should be minimal in our study because well over 90% of the eligible cases participated in the study and most cases were interviewed within 30 days of diagnosis. Furthermore, 70–80% of the study subjects gave blood for the study; thus it is unlikely that response status among cases and controls was related to the observed allele frequencies.

This is the first population-based effort in a low-risk population to examine the role of SRD5A2 in prostate cancer. Although we found no statistically significant associations of these four polymorphic markers with prostate cancer risk, a modest effect cannot be ruled out. Furthermore, the V89L and (TA)n markers were associated with serum androgen levels, supporting a role of these markers in prostate cancer etiology. Larger studies, including those on African Americans, are needed to further clarify the role of SRD5A2 and type II 5{alpha}-reductase in prostate cancer and determine whether they can explain the large racial/ethnic difference in prostate cancer risk.


    Acknowledgments
 
We thank the staff of the Shanghai Cancer Institute for specimen collection and processing; collaborating hospitals and urologists for data collection; local pathologists for pathology review; Linda Lannom, John Heinrich, Nancy Odaka, Kimberly Viskul, Mille Bendel, and Harvey Co Chien of Westat for data preparation and management; Mary McAdams, Jean Cyr, and Leslie Carroll of Information Management Systems, Inc. for data analysis; and Janis Koci of the Scientific Applications International Corporation for management of the biological samples.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from California CRP (99-0053V-10150), the T. J. Martell Foundation, and National Cancer Institute Grant CA68581 (to J. K. V. R.). Back

2 To whom requests for reprints should be addressed, at Division of Cancer Epidemiology and Genetics, National Cancer Institute, EPS-MSC 7234, 6120 Executive Boulevard, Bethesda MD 20852-7234. Fax: (301) 402-0916; E-mail: hsinga{at}exchange.nih.gov Back

3 The abbreviations used are: T, testosterone; SSCP, single-strand conformational polymorphism; DHT, dihydrotestosterone; 3{alpha}-diol G, 5{alpha}-androstane-3{alpha},17ß-diol glucuronide; OR, odds ratio; CI, confidence interval; SHBG, sex hormone-binding globulin; UTR, untranslated region. Back

4 A. W. Hsing, A. P. Chokkalingam, Y. T. Gao, G. Wu, X. Wang, J. Deng, J. Cheng, I. A. Sesterhenn, F. K. Mostofi, T. Chiang, Y. L., Chen, F. Z. Stanczyk, and C. Chang. Polymorphic CAG/CAA repeat length in the AIB1/SRC-3 gene and prostate cancer risk: a population-based case-control study, submitted for publication. Back

Received 11/17/00; revised 7/12/01; accepted 8/16/01.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Greenlee R. T., Murray T., Bolden S., Wingo P. A. Cancer statistics, 2000. CA Cancer J. Clin., 50: 7-33, 2000.[Abstract]
  2. Breslow N., Chan C. W., Dhom G., Drury R. A., Franks L. M., Gellei B., Lee Y. S., Lundberg S., Sparke B., Sternby N. H., Tulinius H. Latent carcinoma of prostate at autopsy in seven areas. The International Agency for Research on Cancer, Lyon, France. Int. J. Cancer, 20: 680-688, 1977.[Medline]
  3. Hsing A. W., Tsao L., Devesa S. S. International trends and patterns of prostate cancer incidence and mortality. Int. J. Cancer, 85: 60-67, 2000.[Medline]
  4. Hsing A. W. Hormones and prostate cancer: what’s next?. Epidemiol. Rev., 23: 42-58, 2001.[Free Full Text]
  5. Pollard M., Luckert P. H. Prostate cancer in a Sprague–Dawley rat. Prostate, 6: 389-393, 1985.[Medline]
  6. Bosland M. C., Ford H., Horton L. Induction at high incidence of ductal prostate adenocarcinomas in NBL/Cr and Sprague-Dawley Hsd:SD rats treated with a combination of testosterone and estradiol-17ß or diethylstilbestrol. Carcinogenesis (Lond.), 16: 1311-1317, 1995.[Abstract/Free Full Text]
  7. di Salle E., Giudici D., Radice A., Zaccheo T., Ornati G., Nesi M., Panzeri A., Delos S., Martin P. M. PNU 157706, a novel dual type I and II 5{alpha}-reductase inhibitor. J. Steroid Biochem. Mol. Biol., 64: 179-186, 1998.[Medline]
  8. Thigpen A. E., Davis D. L., Milatovich A., Mendonca B. B., Imperato-McGinley J., Griffin J. E., Francke U., Wilson J. D., Russell D. W. Molecular genetics of steroid 5{alpha}-reductase 2 deficiency. J. Clin. Investig., 90: 799-809, 1992.
  9. Labrie F., Sugimoto Y., Luu-The V., Simard J., Lachance Y., Bachvarov D., Leblanc G., Durocher F., Paquet N. Structure of human type II 5{alpha}-reductase gene. Endocrinology, 131: 1571-1573, 1992.[Abstract]
  10. Russell D. W., Berman D. M., Bryant J. T., Cala K. M., Davis D. L., Landrum C. P., Prihoda J. S., Silver R. I., Thigpen A. E., Wigley W. C. The molecular genetics of steroid 5{alpha}-reductases. Recent Prog. Horm. Res., 49: 275-284, 1994.
  11. Makridakis N. M., di Salle E., Reichardt J. K. Biochemical and pharmacogenetic dissection of human steroid 5{alpha}-reductase type II. Pharmacogenetics, 10: 407-413, 2000.[Medline]
  12. Ross R. K., Pike M. C., Coetzee G. A., Reichardt J. K., Yu M. C., Feigelson H., Stanczyk F. Z., Kolonel L. N., Henderson B. E. Androgen metabolism and prostate cancer: establishing a model of genetic susceptibility. Cancer Res., 58: 4497-4504, 1998.[Abstract/Free Full Text]
  13. Ross R. K., Bernstein L., Lobo R. A., Shimizu H., Stanczyk F. Z., Pike M. C., Henderson B. E. 5{alpha}-reductase activity and risk of prostate cancer among Japanese and US white and black males. Lancet, 339: 887-889, 1992.[Medline]
  14. Lookingbill D. P., Demers L. M., Wang C., Leung A., Rittmaster R. S., Santen R. J. Clinical and biochemical parameters of androgen action in normal healthy Caucasian versus Chinese subjects. J. Clin. Endocrinol. Metab., 72: 1242-1248, 1991.[Abstract]
  15. Makridakis N., Ross R. K., Pike M. C., Chang L., Stanczyk F. Z., Kolonel L. N., Shi C. Y., Yu M. C., Henderson B. E., Reichardt J. K. A prevalent missense substitution that modulates activity of prostatic steroid 5{alpha}-reductase. Cancer Res., 57: 1020-1022, 1997.[Abstract/Free Full Text]
  16. Makridakis N. M., Ross R. K., Pike M. C., Crocitto L. E., Kolonel L. N., Pearce C. L., Henderson B. E., Reichardt J. K. Association of mis-sense substitution in SRD5A2 gene with prostate cancer in African-American and Hispanic men in Los Angeles, USA. Lancet, 354: 975-978, 1999.[Medline]
  17. Reichardt J. K., Makridakis N., Henderson B. E., Yu M. C., Pike M. C., Ross R. K. Genetic variability of the human SRD5A2 gene: implications for prostate cancer risk. Cancer Res., 55: 3973-3975, 1995.[Abstract/Free Full Text]
  18. Jaffe J. M., Malkowicz S. B., Walker A. H., MacBride S., Peschel R., Tomaszewski J., Van Arsdalen K., Wein A. J., Rebbeck T. R. Association of SRD5A2 genotype and pathological characteristics of prostate tumors. Cancer Res., 60: 1626-1630, 2000.[Abstract/Free Full Text]
  19. Febbo P. G., Kantoff P. W., Platz E. A., Casey D., Batter S., Giovannucci E., Hennekens C. H., Stampfer M. J. The V89L polymorphism in the 5{alpha}-reductase type 2 gene and risk of prostate cancer. Cancer Res., 59: 5878-5881, 1999.[Abstract/Free Full Text]
  20. Lunn R. M., Bell D. A., Mohler J. L., Taylor J. A. Prostate cancer risk and polymorphism in 17 hydroxylase (CYP17) and steroid reductase (SRD5A2). Carcinogenesis (Lond.), 20: 1727-1731, 1999.[Abstract/Free Full Text]
  21. Yamada Y., Watanabe M., Murata M., Yamanaka M., Kubota Y., Ito H., Katoh T., Kawamura J., Yatani R., Shiraishi T. Impact of genetic polymorphisms of 17-hydroxylase cytochrome P-450 (CYP17) and steroid 5{alpha}-reductase type II (SRD5A2) genes on prostate cancer risk among the Japanese population. Int. J. Cancer, 92: 683-686, 2001.[Medline]
  22. Kantoff P. W., Febbo P. G., Giovannucci E., Krithivas K., Dahl D. M., Chang G., Hennekens C. H., Brown M., Stampfer M. J. A polymorphism of the 5{alpha}-reductase gene and its association with prostate cancer: a case-control analysis. Cancer Epidemiol. Biomark. Prev., 6: 189-192, 1997.[Abstract]
  23. Hsing A. W., Deng J., Sesterhenn I. A., Mostofi F. K., Stanczyk F. Z., Benichou J., Xie T., Gao Y. T. Body size and prostate cancer: a population-based case-control study in China. Cancer Epidemiol. Biomark. Prev., 9: 1335-1341, 2000.[Abstract/Free Full Text]
  24. Hsing A. W., Gao Y. T., Wu G., Wang X., Deng J., Chen Y. L., Sesterhenn I. A., Mostofi F. K., Benichou J., Chang C. Polymorphic CAG and GGN repeat lengths in the androgen receptor gene and prostate cancer risk: a population-based case-control study in China. Cancer Res., 60: 5111-5116, 2000.[Abstract/Free Full Text]
  25. Hsing A. W., Chua S., Jr., Gao Y. T., Gentzschein E., Chang L., Deng J., Stanczyk F. Z. Prostate cancer risk and serum levels of insulin and leptin: a population-based study. J. Natl. Cancer Inst. (Bethesda), 93: 783-789, 2001.[Abstract/Free Full Text]
  26. Davis D. L., Russell D. W. Unusual length polymorphism in human steroid 5{alpha}-reductase type 2 gene (SRD5A2). Hum. Mol. Genet., 2: 820 1993.[Free Full Text]
  27. Goebelsmann U., Bernstein G. S., Gale J. A., Kletzky O. A., Nakamura R. M., Coulson A. H., Korelitz J. J. Serum gonadotropin, testosterone, estradiol, and estrone levels prior to and following bilateral vasectomy Lepow I. H. Crozier R. eds. . Vasectomy: Immunologic and Pathophysiologic Effects in Animals and Man, : 165-175, Academic Press New York 1979.
  28. Serafini P., Ablan F., Lobo R. A. 5{alpha}-reductase activity in the genital skin of hirsute women. J. Clin. Endocrinol. Metab., 60: 349-355, 1985.[Abstract]
  29. Wong I. L., Morris R. S., Chang L., Spahn M. A., Stanczyk F. Z., Lobo R. A. A prospective randomized trial comparing finasteride to spironolactone in the treatment of hirsute women. J. Clin. Endocrinol. Metab., 80: 233-238, 1995.[Abstract]
  30. Cassidenti D. L., Pike M. C., Vijod A. G., Stanczyk F. Z., Lobo R. A. A reevaluation of estrogen status in postmenopausal women who smoke. Am. J. Obstet. Gynecol., 166: 1444-1448, 1992.[Medline]
  31. Breslow, N. E., and Day, N. E. Statistical Methods in Cancer Research. Volume I—The Analysis of Case-control Studies. IARC Sci. Publ. No. 32. Lyon, France: IARC, 1980.
  32. Nam R. K., Toi A., Vesprini D., Ho M., Chu W., Harvie S., Sweet J., Trachtenberg J., Jewett M. A., Narod S. A. V89L polymorphism of type-2,5-{alpha} reductase enzyme gene predicts prostate cancer presence and progression. Urology, 57: 199-204, 2001.[Medline]
  33. Allen N. E., Forrest M. S., Key T. J. The association between polymorphisms in the CYP17 and 5{alpha}-reductase (SRD5A2) genes and serum androgen concentrations in men. Cancer Epidemiol. Biomark. Prev., 10: 185-189, 2001.[Abstract/Free Full Text]
  34. Sinnecker G. H., Hiort O., Dibbelt L., Albers N., Dorr H. G., Hauss H., Heinrich U., Hemminghaus M., Hoepffner W., Holder M., Schnabel D., Kruse K. Phenotypic classification of male pseudohermaphroditism due to steroid 5{alpha}-reductase 2 deficiency. Am. J. Med. Genet., 63: 223-230, 1996.[Medline]
  35. Zubiaga A. M., Belasco J. G., Greenberg M. E. The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation. Mol. Cell. Biol., 15: 2219-2230, 1995.[Abstract]
  36. Akalu A., Dlmajian D. A., Highshaw R. A., Nichols P. W., Reichardt J. K. Somatic mutations at the SRD5A2 locus encoding prostatic steroid 5{alpha}-reductase during prostate cancer progression. J. Urol., 161: 1355-1358, 1999.[Medline]
  37. Wadelius M., Andersson A. O., Johansson J. E., Wadelius C., Rane E. Prostate cancer associated with CYP17 genotype. Pharmacogenetics, 9: 635-639, 1999.[Medline]
  38. Habuchi T., Liqing Z., Suzuki T., Sasaki R., Tsuchiya N., Tachiki H., Shimoda N., Satoh S., Sato K., Kakehi Y., Kamoto T., Ogawa O., Kato T. Increased risk of prostate cancer and benign prostatic hyperplasia associated with a CYP17 gene polymorphism with a gene dosage effect. Cancer Res., 60: 5710-5713, 2000.[Abstract/Free Full Text]
  39. Reichardt J. K. GEN GEN: the genomic genetic analysis of androgen-metabolic genes and prostate cancer as a paradigm for the dissection of complex phenotypes. Front Biosci., 4: D596-D600, 1999.[Medline]



This article has been cited by other articles:


Home page
Hum Mol GenetHome page
C. L. Pearce, D. J. Van Den Berg, N. Makridakis, J. K.V. Reichardt, R. K. Ross, M. C. Pike, L. N. Kolonel, and B. E. Henderson
No association between the SRD5A2 gene A49T missense variant and prostate cancer risk: lessons learned
Hum. Mol. Genet., August 15, 2008; 17(16): 2456 - 2461.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
I. Boger-Megiddo, N. S. Weiss, M. J. Barnett, G. E. Goodman, and C. Chen
V89L Polymorphism of the 5{alpha}-Reductase Type II Gene (SRD5A2), Endogenous Sex Hormones, and Prostate Cancer Risk
Cancer Epidemiol. Biomarkers Prev., February 1, 2008; 17(2): 286 - 291.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. Beesley, S. J. Jordan, A. B. Spurdle, H. Song, S. J. Ramus, S. K. Kjaer, E. Hogdall, R. A. DiCioccio, V. McGuire, A. S. Whittemore, et al.
Association Between Single-Nucleotide Polymorphisms in Hormone Metabolism and DNA Repair Genes and Epithelial Ovarian Cancer: Results from Two Australian Studies and an Additional Validation Set
Cancer Epidemiol. Biomarkers Prev., December 1, 2007; 16(12): 2557 - 2565.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
M. T Zarrabeitia, J. L Hernandez, C. Valero, A. Zarrabeitia, J. A Amado, J. Gonzalez-Macias, and J. A Riancho
Adiposity, estradiol, and genetic variants of steroid-metabolizing enzymes as determinants of bone mineral density
Eur. J. Endocrinol., January 1, 2007; 156(1): 117 - 122.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. O. Goodarzi, N. A. Shah, H. J. Antoine, M. Pall, X. Guo, and R. Azziz
Variants in the 5{alpha}-Reductase Type 1 and Type 2 Genes Are Associated with Polycystic Ovary Syndrome and the Severity of Hirsutism in Affected Women
J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 4085 - 4091.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. T. T. Thai, M. Kalbasi, K. Lagerstedt, L. Frisen, I. Kockum, and A. Nordenskjold
The Valine Allele of the V89L Polymorphism in the 5-{alpha}-Reductase Gene Confers a Reduced Risk for Hypospadias
J. Clin. Endocrinol. Metab., December 1, 2005; 90(12): 6695 - 6698.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
B. K. Dunn, D. L. Wickerham, and L. G. Ford
Prevention of Hormone-Related Cancers: Breast Cancer
J. Clin. Oncol., January 10, 2005; 23(2): 357 - 367.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
H. L. Parnes, I. M. Thompson, and L. G. Ford
Prevention of Hormone-Related Cancers: Prostate Cancer
J. Clin. Oncol., January 10, 2005; 23(2): 368 - 377.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
M. Fernandez-Cancio, M. Nistal, R. Gracia, M. A. Molina, J. A. Tovar, C. Esteban, A. Carrascosa, and L. Audi
Compound Heterozygous Mutations in the SRD5A2 Gene Exon 4 in a Male Pseudohermaphrodite Patient of Chinese Origin
J Androl, May 1, 2004; 25(3): 412 - 416.
[Abstract] [Full Text] [PDF]


Home page
Annals of Clinical & Laboratory ScienceHome page
J. Liu, J.-S. Zhang, C. Y. F. Young, and P. C. Kao
Polymorphisms of Prostate-Specific Antigen Gene Promoter: Determination From Cord Blood Collected on Filter Paper
Ann. Clin. Lab. Sci., October 1, 2003; 33(4): 429 - 434.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. Ntais, A. Polycarpou, and J. P. A. Ioannidis
SRD5A2 Gene Polymorphisms and the Risk of Prostate Cancer: A Meta-Analysis
Cancer Epidemiol. Biomarkers Prev., July 1, 2003; 12(7): 618 - 624.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
R. K. Nam, W. W. Zhang, J. Trachtenberg, E. Diamandis, A. Toi, M. Emami, M. Ho, J. Sweet, A. Evans, M. A.S. Jewett, et al.
Single Nucleotide Polymorphism of the Human Kallikrein-2 Gene Highly Correlates With Serum Human Kallikrein-2 Levels and in Combination Enhances Prostate Cancer Detection
J. Clin. Oncol., June 15, 2003; 21(12): 2312 - 2319.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
N. E. Allen, J. K. V. Reichardt, H. Nguyen, and T. J. Key
Association between Two Polymorphisms in the SRD5A2 Gene and Serum Androgen Concentrations in British Men
Cancer Epidemiol. Biomarkers Prev., June 1, 2003; 12(6): 578 - 581.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
S. Bhasin, A. B. Singh, R. P. Mac, B. Carter, M. I. Lee, and G. R. Cunningham
Managing the Risks of Prostate Disease During Testosterone Replacement Therapy in Older Men: Recommendations for a Standardized Monitoring Plan
J Androl, May 1, 2003; 24(3): 299 - 311.
[Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
Y.-M. Sung, N. L.-S. Tang, P. B.-S. Lai, P. K.-S. Chan, and F. K.-L. Chan
Re: Hormonal Markers and Hepatitis B Virus-Related Hepatocellular Carcinoma Risk: A Nested Case-Control Study Among Men
J Natl Cancer Inst, April 2, 2003; 95(7): 559 - 560.
[Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
A. W. Hsing, Y.-T. Gao, S. Chua Jr., J. Deng, and F. Z. Stanczyk
Insulin Resistance and Prostate Cancer Risk
J Natl Cancer Inst, January 1, 2003; 95(1): 67 - 71.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
A. W. Hsing, A. P. Chokkalingam, Y.-T. Gao, M. P. Madigan, J. Deng, G. Gridley, and J. F. Fraumeni Jr.
Allium Vegetables and Risk of Prostate Cancer: A Population-Based Study
J Natl Cancer Inst, November 6, 2002; 94(21): 1648 - 1651.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. M. Lippman and W. K. Hong
Cancer Prevention Science and Practice
Cancer Res., September 15, 2002; 62(18): 5119 - 5125.
[Full Text] [PDF]


Home page
EndocrinologyHome page
J. Simard, M. Dumont, P. Soucy, and F. Labrie
Perspective: Prostate Cancer Susceptibility Genes
Endocrinology, June 1, 2002; 143(6): 2029 - 2040.
[Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
A. W. Hsing, A. P. Chokkalingam, Y.-T. Gao, G. Wu, X. Wang, J. Deng, J. Cheng, I. A. Sesterhenn, F. K. Mostofi, T. Chiang, et al.
Polymorphic CAG/CAA Repeat Length in the AIB1/SRC-3 Gene and Prostate Cancer Risk: A Population-based Case-Control Study
Cancer Epidemiol. Biomarkers Prev., April 1, 2002; 11(4): 337 - 341.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal